ID: 1159986033

View in Genome Browser
Species Human (GRCh38)
Location 18:74841818-74841840
Sequence CAAGCTGGATACTTGAGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159986033_1159986035 4 Left 1159986033 18:74841818-74841840 CCTAGACTCAAGTATCCAGCTTG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1159986035 18:74841845-74841867 GTAAAAATGTCAGCGTCATTAGG 0: 1
1: 0
2: 1
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159986033 Original CRISPR CAAGCTGGATACTTGAGTCT AGG (reversed) Intronic
900017512 1:163031-163053 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
900047771 1:521627-521649 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
900069986 1:763491-763513 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
904452959 1:30628202-30628224 GAAGCTGGGTATATGAGTCTGGG + Intergenic
906160908 1:43648555-43648577 CAAGTTGGATTCTTCAGACTCGG + Intergenic
908649780 1:66319600-66319622 GAACCTGGAAACTTGAATCTAGG - Intronic
911309770 1:96278017-96278039 CAAGCTGGAAACTGGGGACTTGG + Intergenic
911927764 1:103857787-103857809 AAAGATGGATACTAGAGGCTGGG + Intergenic
912353703 1:109038449-109038471 CAGGCAGGTCACTTGAGTCTAGG + Intronic
913686215 1:121234505-121234527 CCAGCTGGTTACTTGAGTGGTGG + Intronic
914038066 1:144022127-144022149 CCAGCTGGTTACTTGAGTGGTGG + Intergenic
914151388 1:145045813-145045835 CCAGCTGGTTACTTGAGTGGTGG - Intronic
914850964 1:151313873-151313895 CCAGCTGGAGATTTGAGTCCTGG + Intronic
917237405 1:172909315-172909337 AAGTCTGGATTCTTGAGTCTTGG - Intergenic
918743013 1:188161073-188161095 CAAGCTGTATGTTTGAATCTTGG - Intergenic
919088213 1:192946851-192946873 CAAGCTGATCACTTGAGTCCAGG - Intergenic
920473538 1:206253064-206253086 CCAGCTGGTTACTTGAGTGGTGG + Intronic
922105356 1:222508948-222508970 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
922265692 1:223981527-223981549 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
923014209 1:230113343-230113365 CAAACTGGATTCCTGAGTCAAGG - Intronic
923169324 1:231398810-231398832 AAAGATGGATATTTGAGCCTTGG + Intronic
923421120 1:233816229-233816251 CGAGGTTGATGCTTGAGTCTTGG + Intergenic
924347530 1:243086479-243086501 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
1066191905 10:33063765-33063787 GAACCTGGTCACTTGAGTCTAGG + Intergenic
1067163088 10:43843399-43843421 CAAGCTGGATGCTGGGGGCTGGG + Intergenic
1069532084 10:69227102-69227124 CAAGCTGCATTCCTGACTCTGGG - Intronic
1071219940 10:83453922-83453944 CAGAATGGATACTTGAGGCTAGG - Intergenic
1073586244 10:104712792-104712814 CAAACTGGATAATTCAGTCAAGG + Intronic
1073599602 10:104833812-104833834 TGAGCTGGATAAATGAGTCTGGG - Intronic
1073743907 10:106443838-106443860 AAAGATGGTTACTAGAGTCTGGG + Intergenic
1075395571 10:122124550-122124572 CTAGCTGGACACTTGGGGCTGGG - Intronic
1075525078 10:123177384-123177406 CCAGATGGATACTTGACTCAAGG + Intergenic
1075772081 10:124947549-124947571 GCAGCTGGATATATGAGTCTAGG - Intronic
1076974109 11:158237-158259 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
1077275862 11:1707525-1707547 GAAGCTGGACACTTGAGTGATGG - Intergenic
1078038349 11:7832890-7832912 AAAGCTGGAGCCTTGGGTCTAGG + Intergenic
1079917688 11:26391077-26391099 AAAACTGAATACTTGAGACTGGG + Intronic
1081599886 11:44485699-44485721 CAGGCTGGATCTTTGACTCTAGG + Intergenic
1084843901 11:71884126-71884148 CAAGCTGGATAATTCATTTTAGG + Intronic
1086566274 11:88230616-88230638 AAAGCAGTTTACTTGAGTCTTGG + Intergenic
1088560757 11:111113408-111113430 CAAGGTGAAGACTGGAGTCTTGG - Intergenic
1089640591 11:119844954-119844976 CTTGCTGGAAACTTGGGTCTCGG - Intergenic
1093711369 12:22333822-22333844 CAACCTGGAGACTTTAGTCAGGG - Intronic
1095286403 12:40416188-40416210 GAGGCTGGAAACTTGAGTCCTGG + Intronic
1097335944 12:58383466-58383488 CAAGCTGGAGACTTGACCCAGGG + Intergenic
1098106986 12:67078791-67078813 CAACCTGCAAACTTCAGTCTCGG + Intergenic
1100168607 12:91946719-91946741 CATCCTGGATACTTGAGTTTTGG - Intergenic
1101638890 12:106571056-106571078 CAAGCAGATCACTTGAGTCTAGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102533427 12:113563784-113563806 GAAGGTGGAGACTTGAGTCTCGG - Intergenic
1103788576 12:123452365-123452387 CAAGAGGGTCACTTGAGTCTGGG + Intergenic
1106880544 13:34124773-34124795 CAAGCTGTATACATTAATCTTGG + Intergenic
1107307903 13:39042620-39042642 CCTGTAGGATACTTGAGTCTGGG - Intronic
1109109754 13:58301821-58301843 CAAGCTGGAGATGTGAGTCATGG - Intergenic
1110052312 13:70919753-70919775 AATGCTGGATACTAGAGGCTGGG - Intergenic
1112312784 13:98334285-98334307 AAAGCTGGACACTTGAGCCCTGG - Intronic
1113183318 13:107657231-107657253 TAAACTGGATACATGGGTCTGGG - Intronic
1113744546 13:112734459-112734481 CAAACTGGAAAAGTGAGTCTGGG + Intronic
1113795425 13:113054635-113054657 CAAGCTGGATAGGTGTGGCTTGG + Intronic
1115759579 14:36565895-36565917 CAGGCTGATTACTTGAGCCTAGG - Intergenic
1116937857 14:50760652-50760674 CCAACTGTAAACTTGAGTCTTGG + Intronic
1119057744 14:71440423-71440445 CAGGCCGACTACTTGAGTCTAGG + Intronic
1119403600 14:74381344-74381366 CAAGCTGTATACTTGTGTTTGGG + Intergenic
1119995108 14:79245021-79245043 CAGGCTGGAGACTTGAGACTGGG - Intronic
1126251740 15:46575397-46575419 CAGGCAGATTACTTGAGTCTAGG + Intergenic
1126700576 15:51363145-51363167 GTAGCTGCATACTTGGGTCTGGG + Intronic
1126768810 15:52034923-52034945 CAAGCAGATCACTTGAGTCTGGG - Intronic
1128291655 15:66482788-66482810 AAAGGTGGAAACGTGAGTCTGGG + Intronic
1129034701 15:72642081-72642103 CAGCCTGGATACTTGAGCCCTGG + Intergenic
1129215181 15:74095135-74095157 CAGCCTGGATACTTGAGCCCTGG - Intergenic
1129456565 15:75679144-75679166 GTAGCTGGAAACATGAGTCTGGG - Intronic
1129534519 15:76301355-76301377 TGTGCTGGATACTGGAGTCTAGG - Intronic
1130303337 15:82696995-82697017 CAAGCTGGGTTCTTGTGCCTGGG - Intronic
1130756769 15:86772459-86772481 GCAGCTGGAAAGTTGAGTCTAGG + Intronic
1131841766 15:96444913-96444935 CAAGCTGGATCCTTAAGCTTTGG + Intergenic
1133007943 16:2895018-2895040 CAAGCTGCAGTCTTGTGTCTAGG + Intronic
1135027381 16:19009100-19009122 CAAGCAGGAAACTTGGATCTTGG - Intronic
1135480543 16:22817383-22817405 CAAGCTAAACACTTGACTCTAGG - Intronic
1139844961 16:69914246-69914268 GAATCTGGATACTTGAGTTCTGG - Intronic
1140357821 16:74321021-74321043 CAGGCTGGAAACTGGGGTCTTGG + Intergenic
1140518324 16:75560781-75560803 CAAGAAGGATACTTGAGCCCAGG - Intergenic
1142110437 16:88328204-88328226 CAGGCCGGACACTTCAGTCTTGG + Intergenic
1142446150 16:90139426-90139448 CAAGCTGGTGACTTGAGTGGTGG + Intergenic
1142461355 17:96037-96059 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
1142788626 17:2245361-2245383 CAAGCTGGAAACTGCAATCTGGG + Intronic
1143968255 17:10772744-10772766 CAAGGAGGATCCTTGAGTCCTGG + Intergenic
1144855613 17:18265784-18265806 CAGGCTGGATAAGGGAGTCTTGG + Intronic
1148490649 17:48021952-48021974 CAGGCAGGTTGCTTGAGTCTGGG - Intergenic
1152230004 17:79109711-79109733 CAGGCTGGATTCCTGAATCTGGG - Intronic
1154058467 18:11034877-11034899 AGTGCTGGATACTTGATTCTGGG - Intronic
1158993740 18:62896095-62896117 CAAGCTGGGTAATTGAATGTGGG + Intronic
1159986033 18:74841818-74841840 CAAGCTGGATACTTGAGTCTAGG - Intronic
1160651057 19:228404-228426 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
1161310753 19:3592877-3592899 CAAGCTGGATTCTAGGGTCAAGG - Exonic
1165303564 19:34989047-34989069 AAAGCTGGATACCAGATTCTGGG - Intergenic
1165314743 19:35047768-35047790 CAAGCAGATAACTTGAGTCTGGG + Intronic
1166695799 19:44851000-44851022 GAAGCTGGACACCTGGGTCTAGG - Intronic
1167901546 19:52625879-52625901 CTAGCTGGATCCCTGAGTCTGGG + Intronic
1167981987 19:53283050-53283072 GAAGCTGGAAACTGGAGTATGGG - Intergenic
925559087 2:5168410-5168432 CATGGTGGATACCTGAGGCTGGG + Intergenic
926345424 2:11940621-11940643 CTAGATGGATAGTTGCGTCTTGG + Intergenic
927994805 2:27477050-27477072 CAAGCAGATTACTTGAGTCCAGG - Intronic
929019113 2:37532747-37532769 CAAGCATGATCCATGAGTCTGGG + Intergenic
929100578 2:38308435-38308457 AAAGATGGTTACTAGAGTCTAGG + Intronic
931926317 2:67076431-67076453 GAAACTGGATACTTCATTCTAGG + Intergenic
937018986 2:118633306-118633328 GAAGCTGGAGTCTTGAGTTTGGG - Intergenic
938146480 2:128838861-128838883 CTAGCTAGACTCTTGAGTCTGGG + Intergenic
938883015 2:135611192-135611214 CAAGCAGAATGCTTGAGTCCAGG + Intronic
941943585 2:171070435-171070457 AAAGATGGTTACTAGAGTCTGGG - Intronic
945639187 2:212400837-212400859 TAAACTGGCTACTTGGGTCTGGG + Intronic
1169341933 20:4803136-4803158 CAAGCAGGTTGCTTGAGTCCAGG - Intronic
1169462858 20:5811557-5811579 CAAGCTGGAGACCTGAGGCTGGG + Intronic
1174043105 20:47713927-47713949 CAAGCTCATTACTGGAGTCTCGG - Intronic
1181372510 22:22429536-22429558 CAGGCTGGATTCTTCATTCTTGG - Intergenic
1182325602 22:29510367-29510389 CAAGCTGATCACTTGAGCCTAGG + Intronic
1184141261 22:42578689-42578711 CGAGCTGGACACTTGCGACTGGG + Intergenic
949842150 3:8331457-8331479 CAAGATGACTACTGGAGTCTTGG + Intergenic
953309715 3:41864684-41864706 CAAGCAGGTTGCTTGAGTCCAGG + Intronic
954174667 3:48834631-48834653 CAAGAGGGTTACTTGAGCCTGGG + Intronic
962041130 3:131708402-131708424 AATGCTGAATACATGAGTCTGGG + Intronic
962566868 3:136669584-136669606 CAGGCAGGTCACTTGAGTCTAGG - Intronic
964207801 3:154194053-154194075 CAGGCAGAATACTTGAGTCCAGG - Intronic
967354733 3:188555789-188555811 ACAGCTGTATATTTGAGTCTGGG + Intronic
968366774 3:198191583-198191605 CAAGCTGGTGACTTGAGTGGTGG + Intergenic
968739958 4:2322441-2322463 CAGGCTGGATCCTGGGGTCTCGG + Intronic
969784980 4:9450079-9450101 CAAGCTGGATAATTCATTTTAGG + Intronic
971030849 4:22635163-22635185 CCAGCTGGACTCCTGAGTCTGGG + Intergenic
973255905 4:48113103-48113125 CAAGCAGGATACTAGATTCTGGG + Intronic
973534981 4:51872101-51872123 CAGGCAGGATCCTTGAGCCTGGG + Intronic
977368258 4:96101296-96101318 TAAGCAGGAAACTTGAGACTAGG - Intergenic
979255186 4:118601192-118601214 CAAGCTGGTGACTTGAGTGGTGG + Intergenic
979333152 4:119439316-119439338 CAAGCTGGTGACTTGAGTGGTGG - Intergenic
981247067 4:142553301-142553323 CAAGTTGGATACATAAGTCTAGG - Intronic
985614131 5:909392-909414 GAAGCTGGATTGTTGAGTGTGGG + Intronic
990930035 5:61078511-61078533 CAAGCAGGTCACTTGAGTCCAGG + Intronic
994009195 5:94879936-94879958 CTAGATGCATTCTTGAGTCTTGG + Intronic
1000228237 5:159290597-159290619 CAAGCTGGACACTTAATCCTGGG - Intergenic
1000230756 5:159313055-159313077 CAAGCTAGAGACTTCAGGCTAGG - Intergenic
1002725997 5:181296783-181296805 CAAGCTGGTGACTTGAGTGGTGG + Intergenic
1005610221 6:27516718-27516740 TAAGCTGGATATTTGAGTTTAGG - Intergenic
1006258300 6:32848477-32848499 CAAACTGGGTTCTTGAGTTTGGG + Intronic
1009681413 6:66897570-66897592 CAGGCTTGATACATAAGTCTGGG - Intergenic
1010233386 6:73554966-73554988 CAAGCGGATCACTTGAGTCTAGG - Intergenic
1010576408 6:77537210-77537232 CTAGCTGAATACTTGATTCATGG - Intergenic
1011693247 6:89888467-89888489 CAAGCAGGTTACTTGAGCCCAGG - Intergenic
1012300364 6:97579984-97580006 CAAGCTGGACACCTTAGTTTAGG + Intergenic
1015135596 6:129866032-129866054 AAATCTGGACACTTGAGTTTTGG + Intergenic
1015683400 6:135833192-135833214 CAAGCAGGCTACTTTAGGCTGGG - Intergenic
1016209812 6:141517081-141517103 CAAGCAGATTGCTTGAGTCTGGG - Intergenic
1020669889 7:11093733-11093755 CAAGCTTGGTTCTTGAGTGTAGG + Intronic
1021778131 7:24073786-24073808 CAGGCTGGCTAATTGAGACTTGG + Intergenic
1022288685 7:28979892-28979914 CCAGCTGGATGAGTGAGTCTGGG - Intergenic
1024275965 7:47677348-47677370 AAAACAGAATACTTGAGTCTGGG - Intergenic
1025988656 7:66477791-66477813 CCAGCTGGTTACTTGAGTGGTGG - Intergenic
1027211625 7:76153796-76153818 CCAGCTGGTTACTTGAGTGGTGG - Intergenic
1028380971 7:90198046-90198068 GGAGTTGGATATTTGAGTCTGGG - Intronic
1031828374 7:126595492-126595514 CAGGCTGATTACTTGAGTCCGGG - Intronic
1032355741 7:131208947-131208969 CAAGCTGGCTATTTTAGACTGGG + Intronic
1035922652 8:3694437-3694459 ACAGCTGCATACATGAGTCTGGG + Intronic
1036546769 8:9778590-9778612 CAAGCTGGGTGTTTGTGTCTTGG + Exonic
1036814745 8:11893491-11893513 CAAGCGGGTCACTTGAGGCTAGG - Intergenic
1038256478 8:25955298-25955320 CAAGCTGGTTTCTTGCCTCTAGG - Intronic
1038868902 8:31471454-31471476 CAGGAGGGACACTTGAGTCTGGG - Intergenic
1042110420 8:65375818-65375840 CATGCTGGATGCCTGAGGCTAGG - Intergenic
1043444932 8:80309986-80310008 CAGGCAGATTACTTGAGTCTAGG + Intergenic
1046487963 8:114910373-114910395 CCAGCTGCATACTTCAGTCCTGG - Intergenic
1046887875 8:119388268-119388290 CAAGCTGGACACTTGTCACTGGG + Intergenic
1047232420 8:123008811-123008833 CAAGCTGGGTCAGTGAGTCTTGG + Intergenic
1047808718 8:128384776-128384798 CAAGGAGGATATTTGGGTCTTGG + Intergenic
1048860497 8:138721310-138721332 TGAGGTGCATACTTGAGTCTGGG + Intronic
1049861816 8:144903797-144903819 GAAGCTGGAGCCTTTAGTCTTGG - Intergenic
1053175008 9:35916204-35916226 CAGGCTGGATTCTGGAATCTAGG + Intergenic
1055316371 9:75038370-75038392 CAAGCAGATCACTTGAGTCTAGG - Intergenic
1056530724 9:87485083-87485105 CAAGCTGGAGACTGGAGTTGAGG - Intergenic
1060644015 9:125262375-125262397 CAAGCTGGACACACGGGTCTGGG + Intronic
1062751131 9:138254427-138254449 CAAGCTGGTGACTTGAGTGGTGG + Intergenic
1187691551 X:21873631-21873653 CACGGTGGATGCCTGAGTCTGGG - Intronic
1188623507 X:32255898-32255920 CAAGTGAGAGACTTGAGTCTGGG + Intronic
1189899972 X:45696404-45696426 CAAACTGGAGACTTGAAACTAGG + Intergenic