ID: 1159988361

View in Genome Browser
Species Human (GRCh38)
Location 18:74872612-74872634
Sequence GAAGCACGTACCACCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34967
Summary {0: 1, 1: 5, 2: 201, 3: 4019, 4: 30741}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159988361_1159988364 -2 Left 1159988361 18:74872612-74872634 CCAGGCGTGGTGGTACGTGCTTC 0: 1
1: 5
2: 201
3: 4019
4: 30741
Right 1159988364 18:74872633-74872655 TCTAGTCCCAGCTACTTGGGAGG 0: 413
1: 46677
2: 166020
3: 229364
4: 230845
1159988361_1159988367 8 Left 1159988361 18:74872612-74872634 CCAGGCGTGGTGGTACGTGCTTC 0: 1
1: 5
2: 201
3: 4019
4: 30741
Right 1159988367 18:74872643-74872665 GCTACTTGGGAGGCTGAAGCAGG 0: 3023
1: 82932
2: 184643
3: 221687
4: 225610
1159988361_1159988369 10 Left 1159988361 18:74872612-74872634 CCAGGCGTGGTGGTACGTGCTTC 0: 1
1: 5
2: 201
3: 4019
4: 30741
Right 1159988369 18:74872645-74872667 TACTTGGGAGGCTGAAGCAGGGG 0: 80
1: 1930
2: 4004
3: 5727
4: 5762
1159988361_1159988371 26 Left 1159988361 18:74872612-74872634 CCAGGCGTGGTGGTACGTGCTTC 0: 1
1: 5
2: 201
3: 4019
4: 30741
Right 1159988371 18:74872661-74872683 GCAGGGGAATCGCTTGAACTGGG 0: 56
1: 4067
2: 52983
3: 120345
4: 143427
1159988361_1159988363 -5 Left 1159988361 18:74872612-74872634 CCAGGCGTGGTGGTACGTGCTTC 0: 1
1: 5
2: 201
3: 4019
4: 30741
Right 1159988363 18:74872630-74872652 GCTTCTAGTCCCAGCTACTTGGG 0: 12
1: 1466
2: 40508
3: 180026
4: 272367
1159988361_1159988372 29 Left 1159988361 18:74872612-74872634 CCAGGCGTGGTGGTACGTGCTTC 0: 1
1: 5
2: 201
3: 4019
4: 30741
Right 1159988372 18:74872664-74872686 GGGGAATCGCTTGAACTGGGAGG 0: 3
1: 195
2: 1007
3: 3256
4: 6706
1159988361_1159988362 -6 Left 1159988361 18:74872612-74872634 CCAGGCGTGGTGGTACGTGCTTC 0: 1
1: 5
2: 201
3: 4019
4: 30741
Right 1159988362 18:74872629-74872651 TGCTTCTAGTCCCAGCTACTTGG 0: 15
1: 1748
2: 41007
3: 146747
4: 151672
1159988361_1159988370 25 Left 1159988361 18:74872612-74872634 CCAGGCGTGGTGGTACGTGCTTC 0: 1
1: 5
2: 201
3: 4019
4: 30741
Right 1159988370 18:74872660-74872682 AGCAGGGGAATCGCTTGAACTGG 0: 2
1: 105
2: 1571
3: 4133
4: 4055
1159988361_1159988368 9 Left 1159988361 18:74872612-74872634 CCAGGCGTGGTGGTACGTGCTTC 0: 1
1: 5
2: 201
3: 4019
4: 30741
Right 1159988368 18:74872644-74872666 CTACTTGGGAGGCTGAAGCAGGG 0: 103
1: 2480
2: 4835
3: 6556
4: 6084

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159988361 Original CRISPR GAAGCACGTACCACCACGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr