ID: 1159988785

View in Genome Browser
Species Human (GRCh38)
Location 18:74877320-74877342
Sequence CTTTCATTGCGGAGGCTGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159988785_1159988789 -1 Left 1159988785 18:74877320-74877342 CCTCACAGCCTCCGCAATGAAAG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1159988789 18:74877342-74877364 GACCACTACAGGACGCACACAGG 0: 1
1: 0
2: 2
3: 4
4: 64
1159988785_1159988792 26 Left 1159988785 18:74877320-74877342 CCTCACAGCCTCCGCAATGAAAG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1159988792 18:74877369-74877391 CCGCGCCGCCTTCCTATCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1159988785_1159988793 29 Left 1159988785 18:74877320-74877342 CCTCACAGCCTCCGCAATGAAAG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1159988793 18:74877372-74877394 CGCCGCCTTCCTATCCCAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159988785 Original CRISPR CTTTCATTGCGGAGGCTGTG AGG (reversed) Exonic
901847189 1:11990911-11990933 CTTTCATGGCGCTGGCTGTGGGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903485214 1:23684852-23684874 CTTTCATGGCGGAATCTGAGTGG - Intergenic
904507953 1:30974657-30974679 CTGTCCTTGCTGAGCCTGTGGGG + Exonic
905317740 1:37094359-37094381 GTTTCAGGGTGGAGGCTGTGGGG - Intergenic
907236272 1:53051723-53051745 TTTTGATTGGGGAGGCAGTGTGG + Intergenic
908187939 1:61670592-61670614 CTGTCCTTCCGGAGGCTGTAGGG - Intergenic
908323518 1:63001065-63001087 TTCTCATTTTGGAGGCTGTGAGG - Intergenic
911634793 1:100222879-100222901 GTTTTAATGCTGAGGCTGTGTGG - Intronic
914390535 1:147217912-147217934 TTATCATTGTGGATGCTGTGGGG - Intronic
915283494 1:154838405-154838427 CCTTCATCCCAGAGGCTGTGGGG - Intronic
920693211 1:208162517-208162539 CTTTCTTTGAGGAGACTATGGGG + Intronic
922496884 1:226063718-226063740 ATTTCACTGCGAAGCCTGTGAGG + Intronic
1067532806 10:47086691-47086713 CCTTCAGTGAGGAGGCGGTGGGG - Intergenic
1071127595 10:82353381-82353403 CTTTCATTGCAAAATCTGTGGGG + Intronic
1075421866 10:122307724-122307746 CCCTCATTCCTGAGGCTGTGGGG - Intronic
1077139272 11:1016605-1016627 CTGTCATTGGTGGGGCTGTGTGG + Exonic
1091252118 11:134153028-134153050 ATTCCACTGCTGAGGCTGTGGGG + Exonic
1091450544 12:569868-569890 CTTTCACTGCGGGTGCTGGGCGG + Intronic
1097411978 12:59266584-59266606 CTATCATTGCTGTGGCTATGGGG + Intergenic
1103925928 12:124423316-124423338 CTCTCCCTGCGAAGGCTGTGGGG - Intronic
1107630364 13:42336433-42336455 CTTTCCTTCTGGAGGCTCTGAGG - Intergenic
1113434759 13:110282295-110282317 CTGTCATTGCGCAGACTGTGGGG + Intronic
1113638804 13:111942726-111942748 ATTTAATTGTAGAGGCTGTGAGG - Intergenic
1115898218 14:38115058-38115080 TTTTCATTGCTGTGGCTTTGTGG - Intergenic
1119635348 14:76268867-76268889 CTTTCATTCCTGAGGATGAGAGG + Intergenic
1121222210 14:92294639-92294661 CTTTAATTGCAGATGCTGAGAGG - Intergenic
1121293655 14:92798410-92798432 CTTTATTTGTGGAGGATGTGGGG - Intronic
1124577564 15:30923239-30923261 CTCTCATGGAGGAGGGTGTGGGG + Intronic
1124963440 15:34415242-34415264 TTTTCATTGTGGGGGCTGCGGGG - Intronic
1124980061 15:34561468-34561490 TTTTCATTGTGGGGGCTGCGGGG - Intronic
1126182020 15:45794603-45794625 CTTTCTTTGTGGAGGCACTGAGG + Intergenic
1128302412 15:66574823-66574845 CTTTTATTTAGGAGGCTGTTTGG + Intergenic
1128717553 15:69919799-69919821 CTTTCATGGTGGGGGCTCTGAGG + Intergenic
1133657221 16:7877479-7877501 CTTACATTGCACAGGTTGTGAGG - Intergenic
1133701913 16:8316792-8316814 CTTTCTTTCCTGAGCCTGTGTGG - Intergenic
1134055563 16:11167709-11167731 CTCTCAGTGAGGTGGCTGTGGGG - Intronic
1138047195 16:53737781-53737803 CTTTAATTGGGTAGGCTGGGGGG - Intronic
1138113784 16:54344431-54344453 GTTTCTTTACGGAGGCTCTGTGG + Intergenic
1138594424 16:58022232-58022254 CTTTCAGTGCAGTGGCTGGGAGG - Intergenic
1142302239 16:89265507-89265529 CTTCCCTTCCGGAGGCTCTGAGG - Intergenic
1144816333 17:18038256-18038278 CTTTCATTGCTGATGGTGAGTGG - Intronic
1150470287 17:65431458-65431480 CTTCCAGAGCAGAGGCTGTGGGG + Intergenic
1152527062 17:80894329-80894351 CTCTCACTGCGGACACTGTGTGG - Intronic
1155250001 18:23945256-23945278 CTTTGCTTGCGGAGGCTGTGGGG + Intronic
1155483437 18:26314814-26314836 CTTTCATTGCAGAGGATTTATGG + Intronic
1156056505 18:33011460-33011482 CGCTCATTGAGGAGACTGTGGGG - Intronic
1157523850 18:48363915-48363937 CCTTCATCTGGGAGGCTGTGGGG - Intronic
1159988785 18:74877320-74877342 CTTTCATTGCGGAGGCTGTGAGG - Exonic
1160416557 18:78716110-78716132 CTTTCAGGGTGGAGGCAGTGTGG + Intergenic
1161933614 19:7357448-7357470 CTTTTATGGCTGATGCTGTGGGG + Intronic
1162796549 19:13090291-13090313 CTGTCGTTGCGAATGCTGTGGGG - Exonic
1162844570 19:13382410-13382432 CTTCCAGGGAGGAGGCTGTGAGG - Intronic
1163624154 19:18379017-18379039 CTCTCATTTCAGAGGCTCTGAGG + Intronic
929464199 2:42130024-42130046 CGTTCATTCCCGAGGCTTTGGGG - Intergenic
935001791 2:99024881-99024903 CATCCATTGAGAAGGCTGTGTGG + Intronic
935383794 2:102480170-102480192 CTTTCATAGAGGAGGAGGTGAGG - Intronic
936086553 2:109473444-109473466 TTTTATTTGGGGAGGCTGTGGGG + Intronic
936530689 2:113275290-113275312 CTTGCATTGTGGAGGGTGGGGGG + Intronic
940699102 2:157019607-157019629 TTTTCTTTCTGGAGGCTGTGGGG - Intergenic
947495840 2:230635991-230636013 ATTTGATTGGTGAGGCTGTGGGG + Intergenic
948084556 2:235236672-235236694 CTCTCATTGCGGAGGCTTCCTGG + Intergenic
1168852907 20:988901-988923 CATTTATGGAGGAGGCTGTGGGG - Intronic
1169898645 20:10531320-10531342 CTTTCATTGCATAGGGTTTGAGG + Intronic
1169953920 20:11080374-11080396 CGATAATTGCTGAGGCTGTGAGG + Intergenic
1178973246 21:37199767-37199789 CTTTCATTCAGCAGGCTGTTGGG + Intronic
1179434448 21:41350569-41350591 CATTGATTGCAGAAGCTGTGCGG - Intronic
1183465458 22:37978087-37978109 CCTTCATCGAGGAGGCTGAGCGG - Exonic
1183553479 22:38506927-38506949 CTTTCTTTCCGGAGTTTGTGAGG + Intronic
1184080363 22:42214976-42214998 CCTTCGCTGAGGAGGCTGTGGGG + Exonic
955692408 3:61603677-61603699 CTTTCATTTTGGAGGCTCTGAGG + Intronic
960269679 3:115660008-115660030 TTTTCATCGCAGAGGCTTTGGGG + Intronic
962249944 3:133829783-133829805 CTTTCCTTGCCTTGGCTGTGAGG + Intronic
963107385 3:141658932-141658954 GTTTCCTTACGGAGGCTTTGGGG + Intergenic
968068933 3:195774029-195774051 CTGACATTAAGGAGGCTGTGGGG + Intronic
970027362 4:11637471-11637493 CATTCATTCTGGATGCTGTGGGG + Intergenic
974670213 4:65020627-65020649 GTTTCCTTGTGGAGACTGTGAGG - Intergenic
976718393 4:88147162-88147184 CTTTCATAGGGAAGCCTGTGAGG - Intronic
977956103 4:103027887-103027909 TTTTCATTTAGGAGGCTTTGGGG - Intronic
982778966 4:159470319-159470341 CAGTCATTGTGGAGGCAGTGTGG + Intergenic
984924538 4:184795015-184795037 CTTTCATTGAGGCGGGTTTGTGG - Intronic
986348102 5:6853086-6853108 TTTTCATTGCAGAGGTGGTGTGG + Intergenic
987253361 5:16122962-16122984 CTTTCAGTGTTGATGCTGTGAGG + Intronic
988523526 5:31966873-31966895 CTTTCTTTTCAGAGGCTCTGTGG - Intronic
990622176 5:57571550-57571572 CTTGCTTTGCTGAGGCTGGGTGG + Intergenic
994210492 5:97083386-97083408 CTATCATTGGTGAGTCTGTGAGG - Intergenic
997757972 5:136418259-136418281 TTTTAATTCAGGAGGCTGTGTGG + Intergenic
1000187857 5:158878331-158878353 CTTTGATTTGGGAGGCTCTGTGG - Intronic
1000485380 5:161835716-161835738 CTCTCCTTGCTGAGGCTATGTGG + Intergenic
1001441416 5:171746393-171746415 CTTTAATTGAGGAGTCTGTAAGG - Intergenic
1001702300 5:173715839-173715861 CTTGCTGTGCGCAGGCTGTGTGG + Intergenic
1001704182 5:173729940-173729962 TTTTCATGGCAGAGGCTCTGGGG - Intergenic
1001778313 5:174345626-174345648 CTTTCATTCTGGAAGTTGTGTGG + Intergenic
1005496595 6:26393024-26393046 CTTTCATTAGGGGGGTTGTGCGG - Exonic
1008692373 6:53994118-53994140 AGTTCATTGCTGGGGCTGTGAGG - Intronic
1018209786 6:161469711-161469733 CATTCCTTCTGGAGGCTGTGGGG - Intronic
1019209429 6:170393318-170393340 CTTTCATTTCAGAGGCCATGAGG + Intronic
1023514185 7:40984122-40984144 CTTTCATTACAGAGGCTGAAAGG - Intergenic
1025236547 7:57238450-57238472 CTTACATTGCGCTTGCTGTGTGG - Intergenic
1028333270 7:89622711-89622733 CATTCCTTGCAGAGACTGTGAGG + Intergenic
1029353733 7:100034382-100034404 CTTTCCCTGCAGGGGCTGTGTGG - Exonic
1030066251 7:105661430-105661452 CTTTAATTCAGGAGGCAGTGAGG + Intronic
1030938568 7:115616847-115616869 CTTTCATGGCAAAAGCTGTGGGG + Intergenic
1034934204 7:155187983-155188005 CTCTCATGGTGGGGGCTGTGGGG - Intergenic
1036809416 8:11857400-11857422 CTCACAGTGTGGAGGCTGTGTGG - Intronic
1037920211 8:22800664-22800686 CTTTTATCCCGGAGGCTCTGAGG - Intronic
1038329756 8:26598810-26598832 CTTTCATTTTGCAGGCGGTGGGG + Intronic
1040496563 8:47970702-47970724 CTTTCATTACGTACGCAGTGAGG - Exonic
1041068041 8:54101516-54101538 CCTGCATTGCGGAGGAAGTGTGG - Intronic
1045231525 8:100310665-100310687 CTGTCTTTGCAGAGGCTGTTAGG + Intronic
1050150749 9:2617242-2617264 CTTTCTATGCTGAGGCTGTGGGG + Intergenic
1050694311 9:8261856-8261878 CTTTCTCTGTGGAGGCAGTGGGG + Intergenic
1051220491 9:14843437-14843459 ATGTAATTGCGGAGGCTGAGAGG - Intronic
1055361138 9:75491626-75491648 ATTTCATTTTGGAGGCAGTGAGG + Intergenic
1056224616 9:84482958-84482980 CATTCATTCCGGAGTATGTGAGG + Intergenic
1056925527 9:90831000-90831022 TTTGCATTGAGGGGGCTGTGTGG + Intronic
1186169802 X:6864640-6864662 CGTTCATTCTGGAGGCTCTGGGG + Intergenic
1187193365 X:17057811-17057833 CTCTCATTGCCAAGGCAGTGCGG + Intronic
1189958585 X:46303259-46303281 CATTCTTTCCGGAGGCTCTGGGG - Intergenic
1190562349 X:51697718-51697740 GTTTCTCTGCGGAGGCTCTGAGG - Intergenic
1193726402 X:85044608-85044630 CTTTTATTGAGGAGGCAGTATGG - Intronic
1196421113 X:115522408-115522430 CTTTCATTTAGGTGGCTGTTTGG + Intergenic