ID: 1159988851

View in Genome Browser
Species Human (GRCh38)
Location 18:74878160-74878182
Sequence TAAGCTTGTAAGGAAGTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159988851_1159988854 6 Left 1159988851 18:74878160-74878182 CCCAAAACTTCCTTACAAGCTTA 0: 1
1: 0
2: 2
3: 15
4: 166
Right 1159988854 18:74878189-74878211 AGTCTCTCCCTAGAGCATTGTGG 0: 1
1: 0
2: 0
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159988851 Original CRISPR TAAGCTTGTAAGGAAGTTTT GGG (reversed) Intronic
902524756 1:17049199-17049221 TAAGCTGGTATGGAATTTCTGGG + Intronic
902527115 1:17066370-17066392 TAAGCTGGTATGGAACTCTTGGG + Intergenic
902658141 1:17883540-17883562 CAATGTTGTAAGGAATTTTTTGG + Intergenic
906740899 1:48182856-48182878 TAAGCATTCAAGGAAGGTTTAGG + Intergenic
907458565 1:54591863-54591885 TAAGCTTGGCAGGTAGGTTTAGG - Intronic
909768925 1:79395271-79395293 TAAATTTGTACAGAAGTTTTAGG - Intergenic
913553605 1:119940876-119940898 CTAGCTTGTAAGAAAGTTTAAGG - Intronic
916982690 1:170155083-170155105 TAAGCTTCTGAGGAGGTCTTAGG - Intronic
917839600 1:178966945-178966967 CAAGCTGGTAAGGAAGTTCAAGG + Intergenic
918941380 1:191002848-191002870 TAAGTTTGTAATGATATTTTTGG - Intergenic
920587922 1:207186505-207186527 TAAGCCACTAAGCAAGTTTTGGG - Intergenic
921712539 1:218387277-218387299 TAAGCTGGAAAGGGAGTTTGGGG + Intronic
921950816 1:220927904-220927926 TAAGCTTGTCAGCAGGTTTGTGG + Intergenic
922050593 1:221986524-221986546 TCTGCTTGTTTGGAAGTTTTAGG - Intergenic
922506744 1:226130652-226130674 TAATCTGGTAAGGGAGTTTAGGG - Intergenic
923993003 1:239460175-239460197 TTAGCTTGTAAGAAAGTGTAAGG + Intronic
1065604322 10:27401320-27401342 TAAGTTTTTAAAAAAGTTTTTGG + Intronic
1067817209 10:49489390-49489412 TAAACTTGTTAGGACTTTTTGGG - Intronic
1073953245 10:108835846-108835868 TAGGCTATTAAGAAAGTTTTGGG - Intergenic
1074685228 10:115955768-115955790 TCATATTGTAAGGTAGTTTTAGG + Intergenic
1075035800 10:119066179-119066201 TAATTTTGTAAGGAAGTCTGGGG - Intronic
1075287002 10:121195487-121195509 GAAACTTGTAAGGATGTTATCGG + Intergenic
1075767637 10:124906838-124906860 TAAACATGTAATGAAGATTTAGG + Intergenic
1076827678 10:132977639-132977661 TGTGCTTGCAAGGAAGTTTCAGG + Intergenic
1086330499 11:85749174-85749196 AAAGTTTTTAGGGAAGTTTTAGG - Intronic
1086573967 11:88316912-88316934 AAAGCTTGAAGGGAAATTTTTGG - Intronic
1088834144 11:113563106-113563128 TCTGCTTGTAAGAAGGTTTTGGG - Intergenic
1090113767 11:123943933-123943955 TCAGAATGTAAGGAAGTGTTGGG - Intergenic
1090871327 11:130752118-130752140 TAGGCTTTAAAGCAAGTTTTCGG + Intergenic
1093284763 12:17245350-17245372 TAAGCATGGGAGGAAGTGTTGGG + Intergenic
1094118277 12:26940317-26940339 TAAACTTGGAAGAAAGATTTTGG - Intronic
1094765082 12:33585186-33585208 TAAGCTAGTAACGTAATTTTGGG + Intergenic
1094860541 12:34461406-34461428 TAAAATTGCAATGAAGTTTTGGG + Intergenic
1096201535 12:49687045-49687067 TAAGATTATCAGGCAGTTTTGGG - Intronic
1096732256 12:53623625-53623647 TCTCCTTGCAAGGAAGTTTTAGG - Intronic
1099045470 12:77711980-77712002 TAAGCTTTTTATGAAGTTGTGGG - Intergenic
1099330224 12:81275730-81275752 AAAGCTTTTAAGGAAAATTTTGG - Intronic
1101869487 12:108552763-108552785 TAAGCCTGTAAGTCAGTTTAGGG - Intronic
1108274050 13:48790107-48790129 TAATGTTGTAAGAAAGTTTAAGG + Intergenic
1109488540 13:63062549-63062571 TGTGCTAGTAAGGAAGATTTAGG + Intergenic
1110708466 13:78623036-78623058 TAAACTACTAGGGAAGTTTTGGG + Intronic
1111752619 13:92353540-92353562 TAAGATTGAAAGGAAGCTTTTGG + Intronic
1112665470 13:101567223-101567245 TAAGCATGTAATGAAATTTATGG - Intronic
1117507214 14:56415734-56415756 TATGCTTGTAAGGATGTTTCTGG - Intergenic
1118089301 14:62455190-62455212 GAAGAATGTAAGGAAATTTTTGG + Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121383915 14:93499677-93499699 TTACCCTGTAAGGCAGTTTTGGG - Intronic
1121659944 14:95627393-95627415 TAATCTTGGAAGGGGGTTTTGGG - Intergenic
1121745325 14:96285040-96285062 TAAACTTGTCTGAAAGTTTTTGG - Exonic
1124132192 15:27000715-27000737 TCAGCTTCTAAGGAAGTCTCAGG - Intronic
1124498739 15:30207970-30207992 TGTGCTTGTATGAAAGTTTTGGG + Intergenic
1124744841 15:32330706-32330728 TGTGCTTGTATGAAAGTTTTGGG - Intergenic
1126207544 15:46062283-46062305 TAAACTTTTGAGGAAGTTTTAGG - Intergenic
1128486654 15:68098002-68098024 TAATATTCAAAGGAAGTTTTGGG - Intronic
1128946456 15:71826091-71826113 TTTGTTTGTAAGTAAGTTTTTGG + Exonic
1135389715 16:22080480-22080502 TAGGCTTTTATGTAAGTTTTAGG - Intronic
1136459952 16:30403916-30403938 TAGTCTAGTAAAGAAGTTTTTGG - Intergenic
1137922270 16:52502101-52502123 CAGGCTTGGAAGGAACTTTTAGG - Intronic
1138050043 16:53766776-53766798 TTAGGTTGTAATGAAGTTTTAGG + Intronic
1140307613 16:73818319-73818341 TCAGCTTGTATGGAAGTTTGTGG + Intergenic
1140517193 16:75552023-75552045 TGAGGATGTAAAGAAGTTTTAGG - Intronic
1141495677 16:84407923-84407945 AAATCTTCTCAGGAAGTTTTGGG + Intronic
1142489408 17:268530-268552 TAAGATTTTAAGTATGTTTTTGG + Intronic
1144557221 17:16292949-16292971 TAAACATGTAAGTCAGTTTTTGG - Intronic
1145354281 17:22124692-22124714 TGTGCTAGTAAGGAAGATTTAGG - Intergenic
1148410329 17:47461268-47461290 TGACCTTTTAAAGAAGTTTTGGG - Intergenic
1149463783 17:56857239-56857261 TAAAATTGGAAGGAAATTTTAGG + Intronic
1154933037 18:21020085-21020107 TAAGCTTTCAAGTAAGTATTTGG + Intronic
1154959278 18:21291702-21291724 CAACCTTATAAGGAAGTCTTGGG - Intronic
1156687228 18:39664857-39664879 TAAGGTGGTGAAGAAGTTTTGGG - Intergenic
1157639688 18:49202091-49202113 TGAGCTGGAAAGAAAGTTTTCGG - Intronic
1158419675 18:57281835-57281857 GAAGGTTGGCAGGAAGTTTTAGG + Intergenic
1159851783 18:73534036-73534058 TAAGAATGCAAGGAAGGTTTTGG - Intergenic
1159988851 18:74878160-74878182 TAAGCTTGTAAGGAAGTTTTGGG - Intronic
1160282103 18:77500586-77500608 TAAGCTCTTGAGTAAGTTTTGGG - Intergenic
1164111526 19:22164554-22164576 TAAGTTTGTAAAAAATTTTTTGG - Intergenic
1167829319 19:52006057-52006079 TTACCTTTTAAGAAAGTTTTAGG - Intronic
926260821 2:11259078-11259100 TGAGCTTTTAAGGGAGATTTAGG + Intronic
926282082 2:11457792-11457814 AAAGCTTGTGAGCAAATTTTGGG - Intronic
926901538 2:17755870-17755892 TTAGCTTTTAAGGAAGTTTTAGG + Intronic
926947542 2:18204199-18204221 TAAGATTTTAAGGTACTTTTGGG + Intronic
927834164 2:26378571-26378593 TAAGCTGGTAAGGAAGACTGTGG + Intronic
930186601 2:48418002-48418024 TAAGCTTTGATAGAAGTTTTAGG - Intergenic
930514100 2:52383739-52383761 TAGGATTGTAATAAAGTTTTGGG - Intergenic
930834721 2:55781130-55781152 TAAACCTTTAAGGAAATTTTTGG + Intergenic
932529321 2:72510464-72510486 TGGGCTTTTAAGAAAGTTTTTGG - Intronic
934051385 2:88214274-88214296 TGAGCTTGGAAAGAACTTTTAGG + Intergenic
934974908 2:98794803-98794825 TCAACATGTAAGGAAGATTTGGG + Intronic
939037498 2:137149904-137149926 TAAGATTTTGAGGAACTTTTGGG + Intronic
939230556 2:139420126-139420148 TAAGCTTGTACGTAAATTTGTGG - Intergenic
940431810 2:153600446-153600468 TAGGCTTAAAAGGAAGTGTTTGG + Intergenic
942212260 2:173683213-173683235 TGAGATTGTTAGGAAGTTTATGG + Intergenic
945370751 2:209014275-209014297 TAAGATTGTAAGCAAATTCTGGG + Intergenic
1173514293 20:43654047-43654069 TAATCTTACAAGGAACTTTTTGG + Intergenic
1178203203 21:30431859-30431881 AAATCTTGTAAGGACCTTTTAGG + Intergenic
1179944410 21:44661528-44661550 TAAGTTTGAAAGGACGTATTAGG + Intronic
951148200 3:19254825-19254847 TGGGCTTGTAACTAAGTTTTAGG + Intronic
953984534 3:47431202-47431224 TAACCTGGTAAGGAAGATGTGGG + Intronic
954303171 3:49711970-49711992 TCAGCCTGTAAGCAAGTTTTAGG - Intronic
955082296 3:55669153-55669175 TAATCTTGTTGGGAAATTTTAGG - Intronic
955736056 3:62039347-62039369 TAAGCTAGTAAGAAATTTCTGGG + Intronic
957303555 3:78425474-78425496 AAATCTTGGAAGGAAGTATTGGG - Intergenic
957408306 3:79801141-79801163 TGACTTTGTAAGGAAGTTTCAGG + Intergenic
959379951 3:105629874-105629896 TAAGCATTCAAGGAAGGTTTTGG - Intergenic
960073050 3:113453188-113453210 TAAGTTAGGAATGAAGTTTTAGG - Intronic
960603643 3:119482517-119482539 TAAACTAGTAAGCAATTTTTAGG + Intronic
960660550 3:120053389-120053411 TTAGATTGTAAGGAAGGTCTGGG - Intronic
970411039 4:15808166-15808188 TAAGGATGCAAGGAAGTGTTTGG + Intronic
971318628 4:25587517-25587539 AAATCTTGTAAGGAAGTCTAAGG + Intergenic
975615856 4:76246122-76246144 TAAGCTGGTAAGCAAGGTTTAGG + Intronic
976539928 4:86262509-86262531 TAAGCATGTCAGGAGGTTTCTGG + Intronic
976855411 4:89598965-89598987 CAAACTTGAAAAGAAGTTTTTGG + Intergenic
978465532 4:109004745-109004767 TCAGCTTCTAGGGAAGTCTTAGG - Intronic
985280275 4:188279574-188279596 TAAGCTTAAAAGTAAGGTTTTGG - Intergenic
987839860 5:23209663-23209685 TAAACTTGTGAAGAAGTTTTAGG - Intergenic
988018226 5:25588802-25588824 TAAGTTTGTCAGGAAGATTTGGG - Intergenic
989667797 5:43876390-43876412 TAAGCTTGGAAGGATGTTTTAGG + Intergenic
989800196 5:45528069-45528091 TAATCTTGTAAGTAAATTTAGGG + Intronic
990491874 5:56310571-56310593 TAAGCTTGCATGGAAGCTTTGGG - Intergenic
990682849 5:58264995-58265017 TAAGATTTTAGGGAATTTTTAGG + Intergenic
992250840 5:74874590-74874612 TAATCTTGTAGGCAAGTCTTTGG - Intergenic
993275696 5:85854279-85854301 TAAGATTGTAAGGAGCTCTTGGG - Intergenic
993668077 5:90726076-90726098 GAAGCATGTATGGAAGTTTAAGG - Intronic
995419975 5:111953481-111953503 TAAAGTTGGAAAGAAGTTTTTGG - Intronic
997653363 5:135537849-135537871 GAAGTCTGTAAGCAAGTTTTTGG + Intergenic
997865345 5:137457609-137457631 TAAGCTAATAAGGATGTGTTGGG + Intronic
998927844 5:147146473-147146495 TAGGCTTTTAAAAAAGTTTTAGG - Intergenic
1008155492 6:48008922-48008944 TAAGCTTATAAGGAAGCTCCAGG - Exonic
1008195934 6:48520720-48520742 TAAGGATGTCAGGAAGATTTAGG - Intergenic
1008902576 6:56638389-56638411 TAGGCTCATCAGGAAGTTTTAGG - Intronic
1011881917 6:92039492-92039514 TAAGCTTGAAAGGGAGGGTTGGG - Intergenic
1013207308 6:107957173-107957195 TAATCTTGTAGGGAATTTTGAGG - Intronic
1013893601 6:115057180-115057202 TATGTTTGTGAGGATGTTTTAGG + Intergenic
1014808624 6:125860174-125860196 TAAACTCTTAAGGAATTTTTTGG + Intronic
1014920046 6:127203238-127203260 TAGGCTTGCAAGGATGTTTATGG - Intergenic
1015232917 6:130937276-130937298 TAAGCTTTTAAAAAAATTTTAGG - Intronic
1016666876 6:146652382-146652404 CAAGCCTTTAAGGTAGTTTTAGG + Intronic
1016871221 6:148818622-148818644 TATGATGGTAAGGAAATTTTAGG + Intronic
1017427973 6:154342223-154342245 TAAGCTTGTAATGACGTTATTGG - Intronic
1018975785 6:168564516-168564538 AAAGCCTGAAAGGAAGTTTCAGG + Intronic
1019023368 6:168937821-168937843 TAAACTTGTAAAGAAGTGTTCGG - Intergenic
1020363109 7:7351181-7351203 CTGGCTTGTAAGGATGTTTTCGG - Intergenic
1021255365 7:18385943-18385965 GCAGCTTGAAAGGTAGTTTTGGG - Intronic
1023060264 7:36320040-36320062 TATGCTTGTCAGCAAGTTGTGGG - Intergenic
1026334810 7:69384493-69384515 GAAGCTTGTAGGAAGGTTTTGGG - Intergenic
1030146978 7:106366942-106366964 TAAGTTTCTAAGGAAGGATTGGG - Intergenic
1030964436 7:115971906-115971928 TAAGCATGAAAGGAATTTATTGG - Intronic
1037045280 8:14293106-14293128 TAAGCTTACAAGGACATTTTTGG - Intronic
1037205272 8:16310004-16310026 TAAAATTGTTAGGAATTTTTTGG - Intronic
1037381150 8:18286613-18286635 TAATCTTGTAAGCATGCTTTAGG + Intergenic
1037447399 8:18980195-18980217 CCAGCTTGTGAGGAACTTTTTGG - Intronic
1038278845 8:26144262-26144284 TAAGCATGTAATGCTGTTTTTGG - Intergenic
1038511715 8:28143454-28143476 CAACTTTGTAAGGAAATTTTTGG - Intronic
1039113912 8:34071080-34071102 TAAGCCTATAAACAAGTTTTCGG + Intergenic
1039504048 8:38038879-38038901 TAATGTTTTAAGGAAGTTTACGG - Intronic
1039545306 8:38405898-38405920 TAAGCTCCTAAGCAAGTTATTGG + Intronic
1040115399 8:43612312-43612334 GAATCTTGTGAGGAAGATTTGGG + Intergenic
1041333553 8:56754392-56754414 TAACCTTGGGAGTAAGTTTTTGG + Intergenic
1041398202 8:57414188-57414210 GAAGCTCGTAAGCATGTTTTGGG + Intergenic
1041754212 8:61295564-61295586 TAAGTTTGAAAGGAATTTTAGGG + Intronic
1044300753 8:90580444-90580466 TGAGCATGTAATGAAGTTCTAGG - Intergenic
1045185710 8:99835638-99835660 TAGGCTTGGAAGTAAGTCTTTGG - Exonic
1045968000 8:108048234-108048256 TCAGCTTGTAAGAAAGTCATGGG + Intronic
1046184982 8:110701493-110701515 TAAGTTTTTAAGGAAATTTGTGG - Intergenic
1047980606 8:130177314-130177336 TAAGTTTATAAGGAAGAGTTTGG - Intronic
1048735508 8:137495874-137495896 TATGTTTGTAAGGAAATTATCGG + Intergenic
1051111196 9:13638706-13638728 TAAGAGTGTAGGGAAGTTTGAGG + Intergenic
1052154020 9:25159645-25159667 TAAGATTATAAGGAATTTTCTGG + Intergenic
1055954311 9:81760241-81760263 TAAGTTTCCAAAGAAGTTTTAGG + Intergenic
1056333108 9:85538098-85538120 TATGCTTTCAATGAAGTTTTAGG + Intergenic
1056531159 9:87488986-87489008 TAAGCTTTTAAGAAACTTGTAGG - Intergenic
1058340393 9:103888278-103888300 TATGCCTGTAAGGGTGTTTTTGG - Intergenic
1058956695 9:109955387-109955409 TAAGTTTGTAAGGAACTTTAGGG + Intronic
1059582013 9:115559981-115560003 TCATCTTTTAAGGAACTTTTAGG - Intergenic
1189064068 X:37787598-37787620 TAAGTTAGTAAGGAAGCTATGGG + Intronic
1191663018 X:63670011-63670033 TAAGCTGGCAAGAAAGCTTTGGG - Intronic
1192868576 X:75163108-75163130 TACAATTGTAAGGAAGTTTTTGG - Intergenic
1193984777 X:88227618-88227640 TAAAATTGAAAGGAAGTCTTAGG + Intergenic
1197569707 X:128133795-128133817 TAAATTTGTATGAAAGTTTTTGG - Intergenic
1197788050 X:130220325-130220347 TGAGTTTGTGAGGGAGTTTTTGG - Intronic
1198657613 X:138932144-138932166 TAAGCTTTTAAGGACGTTGCTGG - Intronic
1199322966 X:146462896-146462918 TAAGTTTGCTAGGAAGTTTTTGG - Intergenic
1199612452 X:149630317-149630339 TGAGGATGAAAGGAAGTTTTAGG - Intronic
1202090383 Y:21182475-21182497 TAACCCTGTAGGGAAGTATTTGG - Intergenic