ID: 1159989525

View in Genome Browser
Species Human (GRCh38)
Location 18:74887352-74887374
Sequence TTGTTTGGGGTACTATAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159989520_1159989525 -9 Left 1159989520 18:74887338-74887360 CCTTGGGTGACCACTTGTTTGGG 0: 1
1: 0
2: 2
3: 7
4: 87
Right 1159989525 18:74887352-74887374 TTGTTTGGGGTACTATAGATGGG 0: 1
1: 0
2: 0
3: 5
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159989525 Original CRISPR TTGTTTGGGGTACTATAGAT GGG Intronic
900498571 1:2988334-2988356 TTGTTTGGGCTACAATAAAAAGG + Intergenic
902731019 1:18368932-18368954 TGGTTTGGGGTGCTGTTGATAGG - Intronic
906543112 1:46603377-46603399 TGGATTGGGGTACTTTAGAAAGG - Intronic
907092032 1:51733831-51733853 ATGTTAGAGGTCCTATAGATTGG - Intronic
907583861 1:55597236-55597258 CTGTTTTGGTTACTATAGCTTGG + Intergenic
908909129 1:69052299-69052321 TTGGTGGGGGTATTATAGCTGGG - Intergenic
909291149 1:73885366-73885388 TTTTTTGGGGTTCCACAGATAGG - Intergenic
912109856 1:106328303-106328325 TGGTTAGGAGTACTATAAATTGG - Intergenic
913032111 1:114918375-114918397 CTGTTTTGGTTACTATAGCTAGG + Intronic
917651258 1:177079650-177079672 TTGTTTGGGATACTAGATTTGGG - Intronic
921630740 1:217430713-217430735 TCTTTTGGGTTACAATAGATAGG + Exonic
922373571 1:224937805-224937827 CTGTTTTGGTTACTATAGTTTGG - Intronic
1063546911 10:6990113-6990135 TTTTTTGAGGTACTATCAATAGG - Intergenic
1068101027 10:52553470-52553492 ATGCTTGTGGCACTATAGATGGG - Intergenic
1069283108 10:66680201-66680223 TTGTTTGTTTTACTAGAGATGGG + Intronic
1077945770 11:6896466-6896488 TTGTTTGTGGTAGCATAAATTGG - Intergenic
1078205603 11:9226700-9226722 TTGTTTAGCTTACTTTAGATCGG - Intronic
1078912085 11:15742176-15742198 GTGTTTGGGCTATTATACATTGG + Intergenic
1079741135 11:24062114-24062136 TTGATTGTGGAAGTATAGATTGG + Intergenic
1085153826 11:74274687-74274709 TTCTTTTGGGTAATATACATAGG + Intronic
1087218908 11:95524536-95524558 TTGTTTCGGGGCCTATAAATTGG + Intergenic
1092637962 12:10472543-10472565 TTGTTTGGGTAACTATAGCCTGG + Intergenic
1095163704 12:38946822-38946844 CTGTTTTGGTTACTATAGCTCGG - Intergenic
1099271705 12:80519054-80519076 TTGCTTTGGGTAGTATAGATAGG + Intronic
1100914788 12:99408104-99408126 CTGTTTTGGTTACTATAGCTTGG - Intronic
1102523701 12:113495523-113495545 CTGTTTGGGGTAATAAAGTTTGG - Intergenic
1102553472 12:113710157-113710179 TTGTTTGGGCTGCTATACACTGG - Intergenic
1105680379 13:22720018-22720040 CTGCTTGGGGGACTATAAATTGG - Intergenic
1106653778 13:31720648-31720670 TTGTTTAGGATAATACAGATGGG + Intergenic
1106882436 13:34146392-34146414 GTGTTTGAGGTATTATCGATGGG + Intergenic
1108972095 13:56389934-56389956 TTGTTTGGGGTATTCTATACAGG + Intergenic
1109916217 13:68988139-68988161 TAGTTTGGAATACTATAGAATGG + Intergenic
1115322145 14:32093727-32093749 CAGTTTGGGGTACTATGAATAGG - Exonic
1116510027 14:45733635-45733657 TTATTCGGTCTACTATAGATGGG - Intergenic
1116943034 14:50809865-50809887 TTGTCTGTAGTACTCTAGATAGG - Intronic
1119530188 14:75354690-75354712 TTGTGTGGGGTGCTATGGATGGG - Intergenic
1119992002 14:79208891-79208913 TTGTTGGTGGGAATATAGATTGG - Intronic
1124429320 15:29592624-29592646 TTCTTGGGGGTGCTATAGTTTGG + Intergenic
1124554756 15:30714338-30714360 CTCTTTTGGTTACTATAGATTGG + Intronic
1124676490 15:31691342-31691364 CTCTTTTGGTTACTATAGATTGG - Intronic
1125536619 15:40444313-40444335 ATGTTTGGGGTGCTGTAAATGGG + Intronic
1126441076 15:48689503-48689525 CTGTTTTGGTTACTATAGCTTGG - Intergenic
1129636954 15:77330366-77330388 TGGTTTGGTGTAGAATAGATTGG - Intronic
1140145759 16:72306363-72306385 TTGTTTGGGGTCTTACATATAGG + Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1146075894 17:29728654-29728676 CTGTTTTGGTTACTATAGCTCGG - Intronic
1148881094 17:50727768-50727790 TTGGGTGGGGTAGTGTAGATAGG + Intronic
1149448923 17:56734392-56734414 TTGTTTGGGCTAGTTTAAATTGG - Intergenic
1150959094 17:69894676-69894698 CTGTTTGGGGAACAATAAATGGG - Intergenic
1153084220 18:1264554-1264576 TTGTTTAGGGGATTATACATTGG - Intergenic
1156136104 18:34040223-34040245 TTGTTGGGGGCACAGTAGATTGG + Intronic
1156230033 18:35144579-35144601 TTGCTTCTGGTACTATGGATAGG + Intergenic
1156390533 18:36646478-36646500 TTTTTTGCTGTACTATTGATAGG - Intronic
1156980712 18:43285322-43285344 TCGGTTGGTGTACAATAGATAGG - Intergenic
1157073288 18:44435106-44435128 TTGTTTTGGTTACTATATCTTGG + Intergenic
1159989525 18:74887352-74887374 TTGTTTGGGGTACTATAGATGGG + Intronic
1162184379 19:8893416-8893438 ATGTTTGTGGTAGTATTGATGGG - Intronic
1166595468 19:44044928-44044950 TTGTTTTGATTACTATAGCTTGG - Intergenic
1167540448 19:50083469-50083491 TTGTTTGTGTTAATAGAGATAGG - Intergenic
1167629259 19:50614329-50614351 TTGTTTGTGTTAATAGAGATAGG + Intergenic
929388258 2:41437392-41437414 CTGTTTTGGTTACTATAGCTCGG + Intergenic
929574832 2:43044813-43044835 TATTTTGGGCTAGTATAGATAGG + Intergenic
930511748 2:52354319-52354341 TTGATTGGGGTTCTAAATATGGG + Intergenic
935849684 2:107204967-107204989 TTGTGTGGGGTTTTAAAGATTGG - Intergenic
942292819 2:174488347-174488369 ATATTTGGGATACTATATATAGG - Intergenic
943376362 2:187082256-187082278 TTTTTCGGAGTACTATTGATTGG + Intergenic
1170379420 20:15740625-15740647 CCATTTGGGGTTCTATAGATAGG + Intronic
1170417520 20:16160165-16160187 TTCTTTTGGGTAATATAAATGGG - Intergenic
1170865539 20:20152055-20152077 TTGTTTGAGGAGCTAAAGATAGG - Intronic
1170887456 20:20353865-20353887 CTGTTGGTGGTAATATAGATTGG + Intronic
1173816139 20:45989595-45989617 TTGTTCTGGGGGCTATAGATGGG - Intergenic
1177693906 21:24546796-24546818 TTTTTAGGGGAACTATAGAAAGG + Intergenic
1203306023 22_KI270736v1_random:109776-109798 TTGATTGGGGTAGAATAGAGTGG + Intergenic
951938321 3:28048810-28048832 TTGTTTTGGCTATTCTAGATTGG - Intergenic
955030938 3:55217210-55217232 TTGTTTGTTGTTCTATTGATGGG + Intergenic
955124426 3:56096741-56096763 TTGTTTGGAGCACTTTAGACTGG - Intronic
955653950 3:61224034-61224056 GTTTTTGGGGTAGTAGAGATGGG - Intronic
957609339 3:82447668-82447690 TTGTTTTGGGATGTATAGATTGG - Intergenic
958163687 3:89851635-89851657 CGGTTTGGGGGACTATGGATGGG + Intergenic
960010453 3:112829144-112829166 TTGTTTGGAGAACTAGAGACTGG + Intronic
961154287 3:124665829-124665851 AAGTTGGGGGTACTATAGATAGG - Intronic
962673122 3:137729549-137729571 TTGTTTAGGTCACTATTGATTGG - Intergenic
963254771 3:143133920-143133942 TTGTTTGAGCCACTGTAGATTGG + Intergenic
964738924 3:159944935-159944957 TTCTATGAGGAACTATAGATTGG + Intergenic
966008135 3:175042533-175042555 TTGTTGGGGGGAATATAAATTGG - Intronic
966115986 3:176461316-176461338 TTGTTTTGGGTTTTCTAGATAGG + Intergenic
966655371 3:182350994-182351016 CTGTTTGGGGGACCATAAATTGG + Intergenic
971173390 4:24257440-24257462 TAGTTTGTGCTACCATAGATTGG - Intergenic
971737316 4:30471336-30471358 TCCCTTGGGGTATTATAGATGGG - Intergenic
974575025 4:63707402-63707424 TAATTTGGGGTGCTATAGTTAGG - Intergenic
975189084 4:71438890-71438912 TTATTTGGGATAATATAAATAGG - Intronic
975231473 4:71939264-71939286 TTGTTATGGAGACTATAGATAGG + Intergenic
975448335 4:74494474-74494496 CTGTTTGTGGGAATATAGATTGG - Intergenic
976869036 4:89768349-89768371 TTGTTGGTGGAAATATAGATTGG - Intronic
978338014 4:107690305-107690327 TTTTTTGGGGAACTGTAGGTAGG - Intronic
980121068 4:128728523-128728545 CTGTTTGGGGAATTATAAATAGG - Intergenic
981334302 4:143551798-143551820 CTGTTTTGGTTACTATAGCTCGG + Intronic
981733429 4:147923773-147923795 TTGTATGGGGTTCTCAAGATGGG + Intronic
983440615 4:167779008-167779030 TTATTTAAGATACTATAGATAGG + Intergenic
990055758 5:51576327-51576349 CTGTTTTGGTTACTATAGCTTGG - Intergenic
992367168 5:76104677-76104699 CTGTTTGCGATACTAGAGATGGG + Intronic
992384670 5:76272439-76272461 TTGTTTGGAATACTATTGTTGGG + Intronic
993769471 5:91907309-91907331 TTGTTTGGGGTAATATTGGAAGG + Intergenic
993840362 5:92870541-92870563 CTGTTTTGGTTACTATAGTTTGG + Intergenic
994991917 5:107007718-107007740 TGGTTTGGAGTAATATAGTTTGG - Intergenic
995749250 5:115437011-115437033 TTCTTTGGGGTATTATATTTAGG + Intergenic
998100427 5:139428764-139428786 TTGTTTTGGGTCCCACAGATTGG - Intronic
999543993 5:152606547-152606569 CTGTTTAGGTTACTATAGCTCGG + Intergenic
1000730776 5:164831024-164831046 TTGTGTGAGGTAATATATATGGG + Intergenic
1001344269 5:170876495-170876517 TTGTTTGGGCTAATCTAGGTGGG + Intronic
1002574262 5:180162547-180162569 TTGCTTGGGGTAATACAGAGAGG - Intronic
1004842695 6:19605560-19605582 TTGCTTATGGTTCTATAGATTGG + Intergenic
1005577188 6:27200884-27200906 TTGCTAGGGCTACCATAGATGGG + Intergenic
1009352061 6:62693049-62693071 TTGTTTTGGTTACTACAGCTTGG - Intergenic
1010853946 6:80814132-80814154 TTGTATATGGTACCATAGATTGG + Intergenic
1011869491 6:91874849-91874871 TTATTTAGGGTAATATACATTGG + Intergenic
1015298945 6:131631235-131631257 TTGTTTGGAGGACTAGAGCTGGG + Intronic
1015306626 6:131715811-131715833 TTGTTGGGGGACCTGTAGATGGG + Intronic
1015370869 6:132451033-132451055 TTGTTTTGGTCCCTATAGATAGG - Exonic
1015441393 6:133250940-133250962 TTTTTTGGGGGGCTATGGATTGG + Intronic
1017052441 6:150406198-150406220 TGGTTGGGGGTACTGGAGATTGG - Intergenic
1021134858 7:16952963-16952985 TTGATTGGGGAACTTTTGATTGG + Intergenic
1022848956 7:34240328-34240350 TTGTTTTGGGGACTAAAGATTGG - Intergenic
1024355970 7:48413481-48413503 TTGTTTGGGGTTCTTGAGGTTGG + Intronic
1024577290 7:50774970-50774992 TTGTTTTTGGTATTAGAGATGGG - Intronic
1025817881 7:64934693-64934715 CTGTTTTGAGTACTATAGCTTGG + Intergenic
1027349529 7:77296727-77296749 TGGTTTGGGGTGCTATATTTAGG + Intronic
1028152053 7:87385077-87385099 CTGTTTTGGTTACTATAGTTTGG + Intronic
1028836225 7:95377762-95377784 TTGTTTGGTGACCTACAGATGGG - Intronic
1030697171 7:112598419-112598441 TTGTTGGTGGGAATATAGATAGG - Intergenic
1031132755 7:117851691-117851713 TGGTTTGGTGGACTGTAGATAGG - Intronic
1031271739 7:119658263-119658285 CTGTTTGTGGGAATATAGATTGG - Intergenic
1031507445 7:122603548-122603570 TTAATTGGGGTAATATAGGTAGG - Intronic
1033730922 7:144178688-144178710 TTGTTGGGGGACCTGTAGATGGG - Intergenic
1035357625 7:158286107-158286129 TTTTTTGAGCTACTATAAATGGG + Intronic
1036049816 8:5183938-5183960 TAGTTTCGGGGACTCTAGATGGG + Intergenic
1041799657 8:61785564-61785586 TTTTCTGGGATACTATAGGTGGG - Intergenic
1043197311 8:77312852-77312874 TTTTTGAGGGTACTATATATGGG - Intergenic
1043522308 8:81059513-81059535 TTGCCTGGAGTCCTATAGATAGG + Intronic
1044146069 8:88715401-88715423 TCCTTTGGGGGACTATATATTGG - Intergenic
1045171220 8:99671083-99671105 TTGTTGGTGGGAATATAGATTGG - Intronic
1047284770 8:123478576-123478598 TTGTATGGGGTAGTAAAGAAAGG + Intergenic
1185853804 X:3513480-3513502 TGGTTTGGGGTCCTCTAGACAGG + Intergenic
1186692035 X:11988193-11988215 CTGTTTTGGTTACTATAGCTTGG - Intergenic
1187587496 X:20679849-20679871 TTGTTTGGAGTACAATAGAATGG - Intergenic
1190188176 X:48254167-48254189 TTGTTGGAGGTACTAGGGATGGG + Intronic
1190657071 X:52621931-52621953 TTGTTGGAGGTACTAGGGATGGG + Intergenic
1193037108 X:76963647-76963669 CTGTTTTGGTTACTATAGCTTGG - Intergenic
1193447985 X:81628763-81628785 TTGTTAGGGATACTGTAGAGGGG + Intergenic
1193819341 X:86143275-86143297 TTGTTGGTGGTGCTATAGACTGG + Intergenic
1197484787 X:127035362-127035384 CTGTTTGGTGTACTATAGCCTGG - Intergenic
1197848694 X:130833293-130833315 TTCTTTGGGGGACTATGGAAAGG + Intronic
1200747250 Y:6913064-6913086 CTGTTTTGGGGACTTTAGATTGG + Intronic
1200809653 Y:7471044-7471066 TGGTTTGGGGTCCTCTAGACAGG - Intergenic