ID: 1159993150

View in Genome Browser
Species Human (GRCh38)
Location 18:74934516-74934538
Sequence TAATCACTTTTAGCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 925
Summary {0: 1, 1: 1, 2: 7, 3: 78, 4: 838}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159993147_1159993150 10 Left 1159993147 18:74934483-74934505 CCTTTTGCATCTTGGAGTAAGGT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1159993150 18:74934516-74934538 TAATCACTTTTAGCTGGGCATGG 0: 1
1: 1
2: 7
3: 78
4: 838

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159993150 Original CRISPR TAATCACTTTTAGCTGGGCA TGG Intronic
901117488 1:6859631-6859653 TAAACAAAATTAGCTGGGCATGG + Intronic
901125712 1:6927178-6927200 GAATGAATATTAGCTGGGCATGG - Intronic
901523375 1:9803111-9803133 TAAGTACTTTTAGCTGGGCGTGG - Intronic
901547952 1:9973389-9973411 TGAAAACTTTTAGCTGGGTATGG - Intronic
901559131 1:10055830-10055852 GAATCACTTGAAGCTGGGGATGG + Intronic
901730495 1:11275586-11275608 TAAAAAATATTAGCTGGGCATGG + Intronic
902367709 1:15988356-15988378 TAAAAACTTTTAGCTGAGAATGG + Intergenic
902424238 1:16306852-16306874 TAATCCATTTTAGCCAGGCATGG - Intronic
902442109 1:16437459-16437481 TAATCACTGTGAGGTTGGCAAGG - Intergenic
902523668 1:17039292-17039314 TAATTACTCTTGGCTGGGCATGG + Intronic
903056662 1:20640878-20640900 AAATAAATTTTAGCCGGGCATGG + Intronic
903521975 1:23957829-23957851 AAATAACAATTAGCTGGGCATGG - Intergenic
903616471 1:24662403-24662425 TAAGAAGTTTGAGCTGGGCACGG - Intronic
903961801 1:27062668-27062690 TAATGACTTTTGGCTGGGCACGG - Intergenic
903994294 1:27296056-27296078 GAATCACATTTGGCTGGGCATGG - Intronic
904226352 1:29024044-29024066 TAATAATTCTTGGCTGGGCACGG + Intronic
904230534 1:29066963-29066985 AAAAAAGTTTTAGCTGGGCACGG - Intronic
904515572 1:31052300-31052322 TACTCATTTTGGGCTGGGCACGG - Intronic
904664912 1:32112783-32112805 TATGTACTTTTGGCTGGGCATGG - Intronic
904692326 1:32302879-32302901 TAAAGATTTTTGGCTGGGCATGG + Intronic
904721168 1:32509707-32509729 AAATCAGTTATGGCTGGGCACGG - Intronic
905661764 1:39732697-39732719 CAGTCACTTTTGACTGGGCACGG - Intronic
905687613 1:39919927-39919949 TATTAAATTATAGCTGGGCACGG + Intergenic
905744922 1:40407192-40407214 TATTCACTTTTGGTCGGGCACGG + Intronic
905904474 1:41608779-41608801 AAATGGCTTTCAGCTGGGCACGG + Intronic
906274163 1:44504003-44504025 TAAAAACAATTAGCTGGGCATGG - Intronic
906466066 1:46080549-46080571 AAACCATTTTAAGCTGGGCATGG - Intronic
906644602 1:47464966-47464988 TAATCATTCTTGGCTGGGCACGG - Intergenic
906888835 1:49684863-49684885 TTATCACTTTTAATTGGGCTGGG - Intronic
907018559 1:51042204-51042226 AAATCACTTTTGGCTGGGCATGG + Intergenic
907067914 1:51504252-51504274 TAAAAACAATTAGCTGGGCAAGG + Intronic
907068094 1:51506175-51506197 TAAACATTGTTGGCTGGGCACGG - Intronic
907142685 1:52202974-52202996 TAATCACTTTGGGCTGTGCGCGG - Intronic
907323983 1:53624694-53624716 TTTTAAATTTTAGCTGGGCATGG - Intronic
907688326 1:56636172-56636194 AAATAAATTTCAGCTGGGCACGG - Intronic
907957171 1:59240945-59240967 TAATAAAAATTAGCTGGGCATGG - Intergenic
908235002 1:62140048-62140070 GAATGACTTTAGGCTGGGCAAGG - Intronic
908261227 1:62340658-62340680 TTATCAAAATTAGCTGGGCATGG - Intergenic
908353646 1:63310682-63310704 ACATCACGTATAGCTGGGCAAGG + Intergenic
908391357 1:63686570-63686592 TAGTGATTTTTGGCTGGGCACGG - Intergenic
908459952 1:64339632-64339654 TAAAAACAATTAGCTGGGCATGG - Intergenic
908577449 1:65475858-65475880 TACAAACATTTAGCTGGGCATGG + Intronic
909000140 1:70207868-70207890 TAAAAACAATTAGCTGGGCATGG - Intronic
909095474 1:71281907-71281929 TAATAATTTTTGGCCGGGCACGG - Intergenic
910307432 1:85782240-85782262 TATTTAAATTTAGCTGGGCATGG - Intronic
911006841 1:93234921-93234943 CACACACTCTTAGCTGGGCATGG - Intronic
912417313 1:109518395-109518417 GAATCACCTTAGGCTGGGCATGG - Intergenic
912791091 1:112651823-112651845 TAATAACTTTTGGCTGGGTGTGG + Intronic
912981186 1:114374754-114374776 TAATTATTCTTAGATGGGCATGG + Intergenic
913371795 1:118107648-118107670 AAAATACTTTTAGCTGGGCATGG - Intronic
913589684 1:120311368-120311390 TTCTCACTTTTGGCTGGGCGCGG - Intergenic
913618501 1:120586998-120587020 TTCTCACTTTTGGCTGGGCGCGG + Intergenic
914257110 1:145969550-145969572 TAAAAATTTTTGGCTGGGCATGG - Intronic
914571712 1:148923226-148923248 TTCTCACTTTTGGCTGGGCGCGG - Intronic
914601122 1:149207036-149207058 TTCTCACTTTTGGCTGGGCGCGG + Intergenic
914741506 1:150469565-150469587 TGAAGACTTTTGGCTGGGCACGG - Intronic
915040805 1:152966914-152966936 AAATTAGATTTAGCTGGGCATGG - Intergenic
915188579 1:154128558-154128580 GAAACACTTTAGGCTGGGCATGG + Intronic
915189794 1:154140058-154140080 AAAACACTTTTGACTGGGCATGG + Intronic
915355347 1:155252351-155252373 TAATAATAATTAGCTGGGCATGG - Intronic
916094727 1:161339136-161339158 TAATCACTATAGGCCGGGCACGG - Intronic
916560828 1:165933051-165933073 CAATCAGTCTTGGCTGGGCACGG - Intergenic
917252957 1:173082151-173082173 TAATAATAATTAGCTGGGCATGG + Intergenic
917741070 1:177962588-177962610 TAAAAAAATTTAGCTGGGCATGG + Intronic
917757039 1:178112259-178112281 AAATCATTGTCAGCTGGGCACGG + Intronic
917804874 1:178604547-178604569 TAGTCTCTTTTGGCCGGGCACGG - Intergenic
917881206 1:179337667-179337689 GGATCTGTTTTAGCTGGGCATGG + Intronic
918033813 1:180845674-180845696 TAATAAAAATTAGCTGGGCATGG - Intronic
918354411 1:183693242-183693264 TAAACATTTCTGGCTGGGCACGG - Intronic
919259983 1:195179621-195179643 TAAAAATTTTTGGCTGGGCACGG + Intergenic
919266407 1:195272772-195272794 TAATCACTTTCTCTTGGGCAAGG + Intergenic
919544936 1:198903745-198903767 TCATTGCTTTTAGCTTGGCAAGG + Intergenic
919632070 1:199969185-199969207 TAAAAACAATTAGCTGGGCATGG - Intergenic
919708598 1:200703875-200703897 AAATTACTTTAGGCTGGGCATGG + Intergenic
920097288 1:203494465-203494487 TTCTTAATTTTAGCTGGGCAAGG - Intronic
920585854 1:207159668-207159690 TAAAAAATATTAGCTGGGCATGG - Intergenic
920774343 1:208921589-208921611 AAACCCCTTTTGGCTGGGCAAGG + Intergenic
920923834 1:210322661-210322683 TAAAAACAATTAGCTGGGCATGG + Intergenic
921022909 1:211252854-211252876 TAAACAAAATTAGCTGGGCATGG - Intergenic
921293238 1:213678111-213678133 CAACCATTTTTTGCTGGGCATGG + Intergenic
922114918 1:222603431-222603453 TAAACACTTTTGGCTGGGCATGG - Intergenic
922147222 1:222959408-222959430 AAATTACTGTTGGCTGGGCACGG + Intronic
922198357 1:223379844-223379866 AAATCACTGTCAGCTTGGCATGG + Intergenic
922202238 1:223415315-223415337 TAGTAGCTTGTAGCTGGGCATGG + Intergenic
922474010 1:225893790-225893812 TAAAAAATTTTGGCTGGGCACGG - Intronic
922489454 1:226004119-226004141 AAATAACCTTTGGCTGGGCACGG + Intergenic
922652085 1:227349264-227349286 AAATCATTATTGGCTGGGCACGG + Intergenic
923210183 1:231796868-231796890 CAAACAAATTTAGCTGGGCAAGG - Intronic
923231469 1:231990405-231990427 TAAACACCTTTAGCTGTGGAGGG - Intronic
923608371 1:235466506-235466528 TTATAAATATTAGCTGGGCATGG - Intronic
923688341 1:236169747-236169769 TACTCAGGTTTGGCTGGGCACGG + Intronic
924082937 1:240418814-240418836 TAAAGACTTATAGCTGTGCATGG + Intronic
924510113 1:244723106-244723128 TAATAATAATTAGCTGGGCACGG - Intergenic
1063307846 10:4922228-4922250 TAGACATTTTTAGGTGGGCATGG - Intergenic
1063849901 10:10175875-10175897 TAAGCATTTTTGGCTGGGCGTGG + Intergenic
1063850630 10:10186008-10186030 TTATTCCTTTTGGCTGGGCATGG + Intergenic
1064201164 10:13286061-13286083 TAATAATAATTAGCTGGGCATGG - Intronic
1064224400 10:13469763-13469785 TCATAACTTTCGGCTGGGCACGG - Intronic
1064270957 10:13865604-13865626 TAAACACAGTTAGCTGGGCATGG - Intronic
1064292157 10:14045056-14045078 TAAGCAAAATTAGCTGGGCACGG - Intronic
1064480839 10:15739041-15739063 TAATAATAATTAGCTGGGCATGG + Intergenic
1064661161 10:17609441-17609463 TGCCCATTTTTAGCTGGGCACGG - Intronic
1064688881 10:17893309-17893331 TAAACAAAATTAGCTGGGCATGG - Intronic
1065019405 10:21491927-21491949 TAATCACATATGGCTGGGCGCGG + Intergenic
1065068007 10:21992018-21992040 TAATAATTTTTGGCTGGACATGG + Intronic
1065437195 10:25714956-25714978 TAAATACTTTTAGCTGTACATGG + Intergenic
1065697447 10:28392710-28392732 TAATAATAATTAGCTGGGCATGG + Intergenic
1065721370 10:28631285-28631307 CAATCACTGTTAGCTGGGCATGG - Intergenic
1066185595 10:33007395-33007417 TATTGAATTTCAGCTGGGCATGG - Intergenic
1066238321 10:33508529-33508551 TAATAATAATTAGCTGGGCATGG + Intergenic
1066618521 10:37320746-37320768 AGATCACTTTGGGCTGGGCATGG - Intronic
1067035451 10:42912274-42912296 TAATAACTCTTGGCTGGGCGTGG + Intergenic
1067901603 10:50247453-50247475 TATTCAGTTTTGGCTGGGCCCGG - Intronic
1068061160 10:52069238-52069260 TAATAAAATTTTGCTGGGCATGG + Intronic
1068114579 10:52723177-52723199 TAAACAAAGTTAGCTGGGCATGG + Intergenic
1068339063 10:55677476-55677498 TAAAAACAGTTAGCTGGGCATGG - Intergenic
1069062023 10:63904138-63904160 TAAAAACTTTAGGCTGGGCACGG - Intergenic
1069497661 10:68920653-68920675 AAATATCTTTTGGCTGGGCACGG + Intronic
1069843924 10:71357539-71357561 TAACCTCTTTGTGCTGGGCATGG - Intronic
1070048509 10:72863234-72863256 TAATCATTTTTGGTTGGTCAGGG - Intronic
1070201497 10:74210037-74210059 TACTCAGTTTTGGCTGGGCGCGG + Intronic
1070291592 10:75119773-75119795 TAAATATTGTTAGCTGGGCACGG + Intronic
1070403709 10:76076051-76076073 TAATAACTTTGGGCTGGGCGCGG + Intronic
1071530383 10:86386778-86386800 TTATCAGTGTCAGCTGGGCATGG + Intergenic
1071893610 10:90040381-90040403 TATTCAATGTTAGCTGGGCATGG + Intergenic
1072498220 10:95984721-95984743 TAAACAAAATTAGCTGGGCATGG + Intronic
1072771078 10:98138399-98138421 TAAACACTTTTGGCTGGGCCTGG + Intronic
1072870336 10:99112577-99112599 TAGTCATTTTTGGCCGGGCACGG - Intronic
1072870541 10:99115137-99115159 AAAACACATTTAGCTGGGCGAGG - Intronic
1072934771 10:99701576-99701598 AAATCACTTTTGGCCGGGCCCGG - Intronic
1073375461 10:103030422-103030444 TAATCAATATTGGCTGGACATGG + Intronic
1074915667 10:117952523-117952545 AAAAGAATTTTAGCTGGGCATGG - Intergenic
1075779901 10:125010653-125010675 AAATCATTTTCAGCTGGGCCAGG - Intronic
1075887362 10:125912791-125912813 AAAACACAATTAGCTGGGCATGG - Intronic
1078041524 11:7868172-7868194 TAAAAATTTTTGGCTGGGCACGG + Intergenic
1078127821 11:8585513-8585535 AAATCATTTTTGGCTGGGCGCGG - Intronic
1078314883 11:10286116-10286138 AAATCTCTTTTGGCTGGGCGTGG - Intronic
1078771124 11:14353087-14353109 AAAAAAATTTTAGCTGGGCACGG - Intronic
1079050875 11:17158057-17158079 TATTAATTTTTGGCTGGGCACGG + Intronic
1079748020 11:24157305-24157327 TAATGAATTTTAGTTTGGCAGGG - Intergenic
1080077779 11:28171945-28171967 TCAAGACATTTAGCTGGGCATGG - Intronic
1080109478 11:28549251-28549273 TCATGACTTTGAGCTGGGCTGGG - Intergenic
1080528559 11:33151341-33151363 TTATAAAATTTAGCTGGGCATGG - Intronic
1080545753 11:33316665-33316687 TAAAAACCATTAGCTGGGCATGG + Intronic
1081954440 11:47077505-47077527 TAAAGATTTTTAGATGGGCAGGG + Intronic
1082218605 11:49604716-49604738 CAAACCCTTTCAGCTGGGCATGG - Intergenic
1083447674 11:62720253-62720275 GAATCAGTATCAGCTGGGCACGG + Intronic
1083652968 11:64214321-64214343 TAAATACAGTTAGCTGGGCATGG - Intronic
1083916395 11:65746868-65746890 TTCTCCCTTTTAGTTGGGCATGG + Intergenic
1084002429 11:66304000-66304022 TAAACATATATAGCTGGGCATGG - Intergenic
1084359152 11:68658360-68658382 TATTCACTGTCAGCCGGGCACGG + Intergenic
1084533307 11:69742151-69742173 AAAAAAATTTTAGCTGGGCATGG + Intergenic
1085080212 11:73627706-73627728 AAATTTTTTTTAGCTGGGCATGG - Intergenic
1085151933 11:74259106-74259128 AAAAAACTTTTGGCTGGGCACGG + Intronic
1085558501 11:77447814-77447836 GAATCTATTTTGGCTGGGCATGG - Intronic
1085940927 11:81206039-81206061 TAATAATTTTAGGCTGGGCATGG + Intergenic
1086081489 11:82907693-82907715 TAAAAAATATTAGCTGGGCATGG - Intronic
1086113478 11:83222957-83222979 GGATCATTTTGAGCTGGGCATGG + Intronic
1086513139 11:87582463-87582485 TAACCATTTTTGGCTGGGCGTGG + Intergenic
1086630965 11:89019402-89019424 CAAACCCTTTCAGCTGGGCATGG + Intronic
1086860962 11:91924491-91924513 TAATCACTTTTAATTGGGCCTGG - Intergenic
1087754023 11:102036248-102036270 AAATAACTTTTGGCTGGGCACGG - Intergenic
1087777534 11:102269972-102269994 TAATCAGGTGGAGCTGGGCAGGG + Intergenic
1087904577 11:103680728-103680750 TAAAAACTTATAGCAGGGCATGG - Intergenic
1088681141 11:112242780-112242802 AAGTGACTTTTGGCTGGGCACGG - Intronic
1088862863 11:113818566-113818588 TAACAATTTTCAGCTGGGCATGG + Intronic
1088887590 11:114020038-114020060 TAATTATTATTGGCTGGGCATGG + Intergenic
1091538955 12:1441349-1441371 CAATCAATTTCAGCCGGGCACGG - Intronic
1092450337 12:8595712-8595734 TAATTATTGTTGGCTGGGCACGG + Intergenic
1093021060 12:14204728-14204750 AAATTATTTTTGGCTGGGCACGG - Intergenic
1094462682 12:30714335-30714357 TAAAAAATATTAGCTGGGCATGG - Intronic
1095311897 12:40708454-40708476 TAATCTCTTTTTGCTGGGAGAGG + Intronic
1096074131 12:48791432-48791454 AATTAAATTTTAGCTGGGCATGG + Intergenic
1096330251 12:50705598-50705620 GGATAATTTTTAGCTGGGCATGG - Intronic
1096451280 12:51744009-51744031 AATTAAATTTTAGCTGGGCATGG + Intronic
1096703698 12:53404824-53404846 TAATAATAATTAGCTGGGCATGG - Intronic
1096872274 12:54600742-54600764 TAAAAACAATTAGCTGGGCATGG - Intergenic
1097127557 12:56786693-56786715 TAAACAAAATTAGCTGGGCATGG + Intronic
1097180785 12:57170663-57170685 TAAACAAAATTAGCTGGGCATGG + Intronic
1097806039 12:63966108-63966130 AATGCACTTTTGGCTGGGCACGG - Intronic
1098302168 12:69065635-69065657 TAAGATATTTTAGCTGGGCATGG - Intergenic
1098616603 12:72533461-72533483 AAATAATTTTCAGCTGGGCATGG - Intronic
1099152055 12:79126547-79126569 TAAACACTTTTGGCCGGGTATGG - Intronic
1099203467 12:79701959-79701981 TAATAATAATTAGCTGGGCATGG - Intergenic
1099847942 12:88053210-88053232 TAATCACTTTTGAATGGGAATGG + Intronic
1099900352 12:88700322-88700344 TAAACAAAATTAGCTGGGCATGG + Intergenic
1100012232 12:89967568-89967590 TGATCACTTAAGGCTGGGCATGG + Intergenic
1100378136 12:94036646-94036668 TAAACACTTTTTGATGGGCTTGG - Intergenic
1101143042 12:101815454-101815476 TAAACAATGTTAGCTGGGCATGG + Intronic
1101441875 12:104709904-104709926 TCAAAACTTTCAGCTGGGCATGG + Intronic
1101632149 12:106505565-106505587 AACTCACTTTTGGCTGGGCATGG - Intronic
1101933514 12:109036002-109036024 TAAACAAAATTAGCTGGGCATGG + Intronic
1102259120 12:111433059-111433081 TAATTACATTGGGCTGGGCACGG + Intronic
1102358911 12:112266635-112266657 TAAAAACAATTAGCTGGGCATGG - Intronic
1102359735 12:112274549-112274571 TAAACAAAATTAGCTGGGCATGG + Intronic
1103009858 12:117449747-117449769 TAAACAAAATTAGCTGGGCATGG + Intronic
1103093601 12:118115509-118115531 TAAAAAGTTTTAGCTGGGCATGG + Intronic
1103275213 12:119705615-119705637 TAATTTTTATTAGCTGGGCATGG + Intronic
1103496458 12:121366408-121366430 TAAACAAAATTAGCTGGGCATGG - Intronic
1103614627 12:122144289-122144311 AAATCAATCTTGGCTGGGCACGG + Exonic
1103768763 12:123303353-123303375 TAATCATTTTAGGCTGGGCACGG + Intronic
1103771720 12:123332137-123332159 TATTCACATTGAGCTGGGCGCGG - Intronic
1103990965 12:124799232-124799254 GAATTAATTTTGGCTGGGCACGG + Intronic
1104333716 12:127872288-127872310 TAATAGGTTCTAGCTGGGCAAGG + Intergenic
1104531989 12:129580546-129580568 AAATCACAATTAGCTGGGCGTGG + Intronic
1104834056 12:131775797-131775819 TAAAATATTTTAGCTGGGCACGG + Intronic
1105462633 13:20606586-20606608 GAATCATTGTTTGCTGGGCACGG + Intronic
1106071327 13:26414097-26414119 AACTGTCTTTTAGCTGGGCATGG + Intergenic
1106398931 13:29409027-29409049 CATCCACTTATAGCTGGGCATGG + Intronic
1107242919 13:38259277-38259299 TTATCACTATTGGATGGGCATGG + Intergenic
1107598439 13:41987932-41987954 TAAGGAATTTTGGCTGGGCATGG - Intergenic
1107839725 13:44443994-44444016 TAATCACATTAGGCTGGGCGTGG + Intronic
1107927122 13:45273808-45273830 TTAAAAATTTTAGCTGGGCATGG - Intronic
1109480619 13:62947028-62947050 TAATCACTTCAGGCCGGGCATGG - Intergenic
1110222986 13:73092371-73092393 TAAAAACTATTAGCTGGGCATGG - Intergenic
1110383690 13:74883413-74883435 TAATAGCTCTTGGCTGGGCATGG + Intergenic
1110423218 13:75336411-75336433 AGATCATTTTGAGCTGGGCATGG + Intronic
1110498777 13:76201125-76201147 TAATAATAATTAGCTGGGCATGG - Intergenic
1112040219 13:95539862-95539884 TGTTTACTTTTGGCTGGGCAAGG + Intronic
1112268540 13:97947899-97947921 AAAATATTTTTAGCTGGGCACGG - Intergenic
1113284545 13:108831801-108831823 AAGTAACTTTCAGCTGGGCATGG - Intronic
1113475782 13:110580178-110580200 TAAAAAAATTTAGCTGGGCATGG - Intergenic
1113798753 13:113075623-113075645 AAATCATTATTGGCTGGGCAGGG - Intronic
1113983752 13:114297539-114297561 TAATCACTATTGGCCGGGCATGG + Intronic
1114274270 14:21127907-21127929 AAATAAAATTTAGCTGGGCATGG + Intergenic
1114878141 14:26749537-26749559 TAAAAACCTTTAGCTAGGCATGG + Intergenic
1115302419 14:31899469-31899491 TATCAACATTTAGCTGGGCATGG + Intergenic
1115498092 14:34026831-34026853 AAATCACTTTCAGTTGGGCATGG + Intronic
1115563977 14:34608735-34608757 TAATAATTTGTGGCTGGGCACGG + Intronic
1115605386 14:34995907-34995929 TAATAAAAATTAGCTGGGCATGG + Intronic
1115810588 14:37102693-37102715 TAGTCAAATTTGGCTGGGCATGG + Intronic
1115932409 14:38511079-38511101 TAAAAAAATTTAGCTGGGCATGG - Intergenic
1116141767 14:41005172-41005194 TAAAAACATTTGGCTGGGCACGG + Intergenic
1116174576 14:41450818-41450840 TCATCAATTTTTCCTGGGCACGG - Intergenic
1117027580 14:51637064-51637086 TAATAATAATTAGCTGGGCATGG + Intronic
1117129544 14:52671546-52671568 TAATTATTTTAATCTGGGCATGG - Intronic
1117314394 14:54559448-54559470 AAAAAAATTTTAGCTGGGCATGG - Intergenic
1117701638 14:58419758-58419780 AAAAAAATTTTAGCTGGGCATGG + Intronic
1117706791 14:58478173-58478195 AAATGATTTTTAGCTGGGCATGG - Intronic
1118821021 14:69346182-69346204 AAATGACTTATGGCTGGGCATGG - Intronic
1118858622 14:69644359-69644381 TAATTAATTATGGCTGGGCACGG + Intronic
1119244098 14:73088848-73088870 AAATCGCTTTTTGCTGGGCACGG + Intronic
1119288022 14:73471855-73471877 GAATCACTGGCAGCTGGGCATGG + Intergenic
1119300606 14:73568626-73568648 TAATAACTATTAGCCGGGCGCGG + Intronic
1119341011 14:73877553-73877575 TAGTCAATTTTGGCTGGGCGTGG - Intronic
1119375903 14:74192576-74192598 TGACCACTGTTGGCTGGGCATGG - Intronic
1119385540 14:74256138-74256160 TAATTACTTTTGGCCAGGCACGG + Intronic
1119492308 14:75046022-75046044 TAAAAAAATTTAGCTGGGCATGG + Intronic
1119573650 14:75698747-75698769 TAAAAACAATTAGCTGGGCATGG + Intronic
1119942847 14:78659524-78659546 TAAAAAAATTTAGCTGGGCATGG + Intronic
1120230354 14:81834979-81835001 AAAAAAATTTTAGCTGGGCATGG - Intergenic
1120528519 14:85605478-85605500 TAATAACTTGTGGCTGGGCACGG + Intronic
1120911585 14:89671765-89671787 TAATCATTTTTGGCCGGGCGCGG - Intergenic
1121091878 14:91188533-91188555 TAATCACTTTTGGCTGGGTGTGG + Intronic
1121345780 14:93134975-93134997 TATTCATTGTTGGCTGGGCATGG - Intergenic
1121487104 14:94325365-94325387 TAAAAAATATTAGCTGGGCATGG - Intergenic
1122110427 14:99496755-99496777 TTATTATTTTTTGCTGGGCATGG + Intronic
1124001083 15:25760688-25760710 TAATTACATGGAGCTGGGCACGG + Intronic
1124718123 15:32086077-32086099 TAAACACTTTTGGCCAGGCACGG + Intronic
1124892642 15:33747099-33747121 AAATCATTTTTGGCTGGGCATGG - Intronic
1125441272 15:39706746-39706768 TAATTACTTTTAGCGGGGATCGG - Intronic
1125545967 15:40505472-40505494 TAAAGATTTTCAGCTGGGCAAGG + Intergenic
1125637531 15:41201776-41201798 GAAGCAATCTTAGCTGGGCACGG - Intronic
1125704716 15:41723569-41723591 TAAAAAGCTTTAGCTGGGCATGG - Intronic
1127507239 15:59609281-59609303 TAATCACTTTAAGATTGGGAGGG - Intronic
1127508044 15:59613859-59613881 TAATAAAAATTAGCTGGGCATGG + Intronic
1128163633 15:65441586-65441608 GAATCACTTGAACCTGGGCAGGG + Intergenic
1128297529 15:66537265-66537287 TAAGCAATTTTTGCTAGGCATGG + Intronic
1128590305 15:68889580-68889602 GAATCATTTTCAGCTGGGCGTGG - Intronic
1128973924 15:72134287-72134309 TTCTCACTTTAAGCTGGGCACGG + Intronic
1129047026 15:72744690-72744712 TAAACAAAATTAGCTGGGCATGG - Intergenic
1129341992 15:74892280-74892302 TAAGGAGTTTTGGCTGGGCATGG - Intronic
1129438905 15:75564811-75564833 AAATAAATTTTGGCTGGGCACGG + Intronic
1129874931 15:78968425-78968447 TAATAATAATTAGCTGGGCATGG - Intronic
1130367065 15:83250279-83250301 TAAACAAAATTAGCTGGGCATGG - Intergenic
1130752450 15:86726715-86726737 TAAAAACAATTAGCTGGGCATGG - Intronic
1130773603 15:86951940-86951962 TAGTCACTCCTGGCTGGGCACGG + Intronic
1130798523 15:87236181-87236203 AAAACATTTTTGGCTGGGCATGG - Intergenic
1131192633 15:90329245-90329267 TAATAAAAATTAGCTGGGCATGG - Intergenic
1131469196 15:92681730-92681752 AAATTACTTTCAGCCGGGCACGG + Intronic
1131808834 15:96151560-96151582 CAAAAACTATTAGCTGGGCATGG + Intergenic
1132407964 15:101556029-101556051 TAATCATTTCCAGCTGGGCTTGG - Intergenic
1133786107 16:8974646-8974668 TAAACAAAATTAGCTGGGCATGG + Intergenic
1134006854 16:10823720-10823742 TGATCACTTGTGGCCGGGCATGG + Intergenic
1134086925 16:11363656-11363678 TAAACACTTTTGGCCGGGCGTGG + Intronic
1134110020 16:11509406-11509428 TACTCAGTGTTGGCTGGGCATGG - Intronic
1134299212 16:12974639-12974661 TAATAAAAATTAGCTGGGCATGG - Intronic
1134647674 16:15883205-15883227 TAAAAAAATTTAGCTGGGCATGG + Intronic
1134834557 16:17350162-17350184 TGATCACTCTTGGCTGGGCACGG - Intronic
1135161331 16:20099151-20099173 TAATAACAATTAGCTCGGCATGG + Intergenic
1135241886 16:20814530-20814552 AATTCAGTTTTCGCTGGGCACGG - Intronic
1135286059 16:21194137-21194159 TAGACACTATCAGCTGGGCATGG - Intergenic
1135410624 16:22231699-22231721 TCATCACTTCTGGCCGGGCACGG + Intronic
1135578163 16:23602252-23602274 TAATCTTCTTTGGCTGGGCACGG + Intergenic
1135671632 16:24380707-24380729 AATTGACTTTTAGCTAGGCATGG + Intergenic
1135732043 16:24902827-24902849 TAATGACTGTTGGCTGGACACGG - Intronic
1135760875 16:25137188-25137210 TACAAACTATTAGCTGGGCATGG - Intronic
1136129840 16:28212607-28212629 TAAAAAAATTTAGCTGGGCATGG - Intergenic
1136519939 16:30788747-30788769 TAAAAACAATTAGCTGGGCAGGG + Intergenic
1139500441 16:67359830-67359852 TACTGATTTTTGGCTGGGCATGG + Intronic
1139568598 16:67796070-67796092 TAAAAAATATTAGCTGGGCATGG - Intronic
1139902041 16:70335735-70335757 TAATAACTGTTGGCTGGGCGCGG - Intronic
1140554942 16:75911194-75911216 AAATCAATCTCAGCTGGGCATGG - Intergenic
1140664737 16:77216931-77216953 CAATTAATTTTAGCAGGGCATGG - Intergenic
1140831179 16:78753002-78753024 TAATCTCTTAGGGCTGGGCACGG + Intronic
1141398572 16:83726543-83726565 ACATCACTGTTGGCTGGGCACGG + Intronic
1141534472 16:84669561-84669583 TAATAATAATTAGCTGGGCATGG - Intergenic
1141834500 16:86529792-86529814 TAAAAAATATTAGCTGGGCATGG + Intergenic
1142208939 16:88798485-88798507 TAATGAATTTTGGCTGGGCATGG + Intergenic
1142413830 16:89930391-89930413 AAACCACTCATAGCTGGGCACGG - Intronic
1142662305 17:1439556-1439578 GAATGAGTTTTAGCTGGGCACGG + Intronic
1142784409 17:2209356-2209378 AAAAAATTTTTAGCTGGGCATGG - Intronic
1143207490 17:5154887-5154909 TAAATACAATTAGCTGGGCATGG - Intronic
1143433494 17:6904578-6904600 TAATAATAATTAGCTGGGCATGG + Intronic
1143800368 17:9374370-9374392 AAATTTCTTTTGGCTGGGCATGG - Intronic
1144108828 17:12011672-12011694 TAAGAACATTTGGCTGGGCATGG - Intergenic
1144135273 17:12289380-12289402 TAAAAACATTTAGCTGGGCATGG - Intergenic
1145039184 17:19564193-19564215 AAATAAAATTTAGCTGGGCATGG + Intronic
1145204463 17:20975291-20975313 TAATCATCATTGGCTGGGCACGG + Intergenic
1145223576 17:21108834-21108856 TAATCTCTTTTAGATTGGGAGGG - Intergenic
1145357940 17:22180714-22180736 TAATCACTTCAAGCTGGGCACGG + Intergenic
1146027792 17:29337766-29337788 AAATAAATTTTAGCTGGGCATGG - Intergenic
1146084118 17:29811722-29811744 AAATAAAATTTAGCTGGGCATGG - Intronic
1146137363 17:30334674-30334696 TAACAAAGTTTAGCTGGGCATGG - Intergenic
1146480566 17:33201874-33201896 TAAAAACAATTAGCTGGGCATGG + Intronic
1147029762 17:37623267-37623289 TAGTCACAATTAGCCGGGCATGG + Intronic
1147125706 17:38366647-38366669 AAATAAATTTTAGCTGGGCTTGG - Intronic
1147216661 17:38903513-38903535 AAATAACAATTAGCTGGGCATGG - Intronic
1147474318 17:40695457-40695479 TAAACAAAATTAGCTGGGCATGG + Intergenic
1147617303 17:41837003-41837025 TAATCAGCGTTGGCTGGGCACGG + Intronic
1147676418 17:42209343-42209365 TAATAACTTTTGGCTGGGTGCGG - Intronic
1147676977 17:42213817-42213839 AAAAGACTTTCAGCTGGGCACGG - Intronic
1147714657 17:42497380-42497402 GAATCATTGTTAGCTGGGCACGG + Intronic
1147959824 17:44160275-44160297 TATTCATATATAGCTGGGCACGG + Intronic
1148411687 17:47472624-47472646 AAATTAATTTTAGCTGGGCATGG - Intergenic
1148614396 17:48988747-48988769 AAAAAACTTTCAGCTGGGCAAGG - Intergenic
1148626254 17:49071223-49071245 TAAAAACTATGAGCTGGGCACGG - Intergenic
1148884139 17:50759325-50759347 TAATCGTTATTGGCTGGGCATGG + Intergenic
1149270796 17:54975295-54975317 TAAGAATTTTTAGCAGGGCATGG - Intronic
1149490694 17:57083279-57083301 CAAAAAATTTTAGCTGGGCATGG + Intergenic
1149712954 17:58759111-58759133 AAAACACACTTAGCTGGGCATGG + Intronic
1149721178 17:58845969-58845991 AAATAAATTTTGGCTGGGCACGG - Intronic
1149747444 17:59113065-59113087 CACTAATTTTTAGCTGGGCATGG + Intronic
1149872869 17:60198958-60198980 TAAATACAATTAGCTGGGCATGG + Intronic
1150050640 17:61958761-61958783 TAGCCACTGTTGGCTGGGCACGG - Intronic
1150097472 17:62390074-62390096 TAATCATTTATGGCCGGGCACGG - Intronic
1150244242 17:63662113-63662135 TAATAACATTGGGCTGGGCATGG + Intronic
1150606471 17:66695391-66695413 TGATGGCTTTTAGCTGGGAATGG + Intronic
1150613569 17:66752302-66752324 TAATCACGTTGGGCTGGGCGTGG + Intronic
1150963589 17:69941153-69941175 TAAAAAATTATAGCTGGGCATGG - Intergenic
1151046689 17:70928740-70928762 TAATAATAATTAGCTGGGCATGG - Intergenic
1151061236 17:71096782-71096804 AAAACACAATTAGCTGGGCATGG + Intergenic
1152036857 17:77878950-77878972 TAAAAAAATTTAGCTGGGCATGG - Intergenic
1152833228 17:82511901-82511923 AAATTATTTTTGGCTGGGCACGG + Intergenic
1153016291 18:585071-585093 TAAAAAATATTAGCTGGGCATGG - Intergenic
1153187156 18:2498613-2498635 CCATCTCTATTAGCTGGGCATGG - Intergenic
1153276348 18:3371683-3371705 TAATCATTTTTGGCTGGACGTGG + Intergenic
1153290982 18:3501206-3501228 TAATCATTGTTGGCTGGGCATGG - Intronic
1154978134 18:21479170-21479192 TAATTAGTCTTGGCTGGGCATGG - Intronic
1155456954 18:26027514-26027536 TAATTAAAATTAGCTGGGCATGG + Intronic
1155480544 18:26282586-26282608 TGATGACTTTTTGCTGGTCAAGG + Intronic
1158212397 18:55066023-55066045 AAAACAGTTTCAGCTGGGCATGG + Intergenic
1158441802 18:57481573-57481595 AAATCACTATTATCTGGGTATGG + Exonic
1158478294 18:57799874-57799896 GTATTACTTTTAGCTGGGCATGG + Intronic
1158968827 18:62647108-62647130 TATACACTGTTGGCTGGGCATGG - Intergenic
1159167200 18:64718835-64718857 TAATCAATTTTGGCCGGGCGCGG - Intergenic
1159315777 18:66771554-66771576 CAATTACATTTAGCTGGGCGTGG - Intergenic
1159503281 18:69301360-69301382 ATCTCACTATTAGCTGGGCATGG - Intergenic
1159515133 18:69448662-69448684 GAATCAATTTGGGCTGGGCACGG - Intronic
1159966001 18:74597257-74597279 AAATGACTTTCAGCTGTGCAAGG - Intergenic
1159993150 18:74934516-74934538 TAATCACTTTTAGCTGGGCATGG + Intronic
1160050563 18:75429535-75429557 TAAGCACTATTTGCTGGGAAGGG + Intergenic
1160175564 18:76591416-76591438 TTAACCATTTTAGCTGGGCATGG - Intergenic
1160203955 18:76817744-76817766 AAATTACTTTGGGCTGGGCATGG + Intronic
1161123949 19:2545493-2545515 AAATCAAAATTAGCTGGGCATGG + Intronic
1161263734 19:3352935-3352957 TACAAACATTTAGCTGGGCATGG - Intergenic
1161375075 19:3935544-3935566 TAAACAATTTTAGCTGGTCGTGG - Intronic
1161391976 19:4025781-4025803 AAATCAGTTTGGGCTGGGCACGG + Intronic
1161417868 19:4157839-4157861 AAATAAATATTAGCTGGGCATGG - Intronic
1161435345 19:4259533-4259555 TAAAAACAATTAGCTGGGCATGG - Intronic
1161503693 19:4632447-4632469 AAATCTTTTTTAGCCGGGCACGG - Intergenic
1161653699 19:5500134-5500156 TAATAAAAATTAGCTGGGCATGG + Intergenic
1161720476 19:5899604-5899626 TAATAATAATTAGCTGGGCATGG - Intronic
1161798024 19:6398830-6398852 AAATCAAAATTAGCTGGGCATGG + Intergenic
1161817803 19:6510526-6510548 GAATCACTTGGACCTGGGCAGGG + Intergenic
1162359407 19:10208960-10208982 AACTCATTTTCAGCTGGGCATGG - Intronic
1162382155 19:10337777-10337799 TAAAAAATATTAGCTGGGCATGG - Intronic
1162450453 19:10751189-10751211 GAATCACTCTGAGCTTGGCAAGG + Intronic
1162751360 19:12831548-12831570 TAATCAAAAATAGCTGGGCATGG + Intronic
1162834436 19:13307111-13307133 TAATAATAATTAGCTGGGCATGG - Intronic
1163069642 19:14828468-14828490 TAAGAACTTCTGGCTGGGCACGG + Intronic
1163101122 19:15097274-15097296 TAAACACTTTGGGTTGGGCATGG + Intergenic
1163216366 19:15880336-15880358 AAATCAATTTTGGCTGGGCGTGG + Intronic
1163534268 19:17868159-17868181 TAAAAATTTTTGGCTGGGCATGG + Intergenic
1163946492 19:20540468-20540490 AAATCATCTTTTGCTGGGCACGG + Intronic
1164109983 19:22147343-22147365 TAAAAAAATTTAGCTGGGCATGG - Intergenic
1164131184 19:22363132-22363154 AAATGACTTTTGGCTGGGCACGG - Intergenic
1164271356 19:23674814-23674836 TAAAAATTATTAGCTGGGCATGG + Intronic
1164631541 19:29765079-29765101 TAAACAATATTAGCTGGGCGTGG + Intergenic
1164898823 19:31900611-31900633 GAATCACAATTAGCTGGGCGTGG - Intergenic
1164929467 19:32164375-32164397 TAAAAATTTTTAGCTGGGCATGG + Intergenic
1165217284 19:34284899-34284921 TAATAATAATTAGCTGGGCACGG + Intronic
1165538082 19:36467143-36467165 TAAAGAATTTCAGCTGGGCATGG + Intronic
1165567426 19:36742979-36743001 AAACAATTTTTAGCTGGGCATGG - Intronic
1165842132 19:38794710-38794732 AAAATAATTTTAGCTGGGCATGG + Intergenic
1166027051 19:40096278-40096300 TAAAAAAATTTAGCTGGGCATGG + Intergenic
1166392266 19:42415518-42415540 GAACCAGTCTTAGCTGGGCATGG + Intronic
1166400765 19:42477935-42477957 TAAACAAAATTAGCTGGGCATGG + Intergenic
1166548715 19:43650742-43650764 TTCTCAGTTTTGGCTGGGCACGG + Intronic
1167012395 19:46817217-46817239 AATTGACTTTTAGCTGGGCATGG - Intergenic
1167372676 19:49093068-49093090 AAAACACTTTTGGCTGGGCATGG - Intronic
1167617859 19:50546012-50546034 TAATAACTTTTAGCCTGGCGCGG - Intronic
1167872712 19:52386510-52386532 TAGTCATTTTTGGCTGGGCGCGG + Intergenic
1168590627 19:57631671-57631693 TAAAAACTTTTGTCTGGGCATGG + Intronic
925039754 2:722584-722606 TAATAAAAATTAGCTGGGCATGG - Intergenic
925090327 2:1149976-1149998 TAATCAACTTCAGCTGGGCGCGG - Intronic
925758710 2:7162453-7162475 AAAACAATTTTAGCTGGGCATGG - Intergenic
927544888 2:23943779-23943801 TAATCTCCTTTAGCTGGGCACGG - Intronic
927631858 2:24781343-24781365 TAATGACTCTCGGCTGGGCACGG + Intergenic
927768218 2:25833402-25833424 TGCTCAATTTTGGCTGGGCATGG + Intronic
927820956 2:26264392-26264414 TAAAAAATATTAGCTGGGCATGG + Intronic
927896038 2:26782740-26782762 TAAAAACAATTAGCTGGGCACGG - Intronic
928360567 2:30659093-30659115 TAATCACTTTGAGCTCAGCATGG + Intergenic
928370446 2:30736559-30736581 CATTCACTTTCAGCTGGGTAAGG + Exonic
930088447 2:47514900-47514922 AAGGAACTTTTAGCTGGGCATGG - Intronic
931308755 2:61058156-61058178 TATTTACTTTAGGCTGGGCACGG + Intergenic
931369590 2:61649933-61649955 TAAAAACTTTTGGCTGGGCATGG + Intergenic
931426976 2:62180159-62180181 GAACCATTTGTAGCTGGGCACGG - Intergenic
931630511 2:64294302-64294324 TACTTAATTTTAGCTGGGCATGG + Intergenic
931748266 2:65309348-65309370 TAAAAACAGTTAGCTGGGCATGG + Intergenic
931885155 2:66609395-66609417 TAATCCCTTTTTGGTGGACAAGG - Intergenic
931994318 2:67825036-67825058 TAATCACTTTTTGGCGGGGAAGG - Intergenic
932116702 2:69056827-69056849 TAAAAAAATTTAGCTGGGCATGG - Intronic
932229696 2:70072759-70072781 TAATAATTTTTTGCAGGGCATGG + Intergenic
932342186 2:70971456-70971478 TAAACAAAATTAGCTGGGCATGG + Intronic
932368723 2:71170140-71170162 TTTTCACTTGTGGCTGGGCATGG - Intergenic
933408765 2:81897834-81897856 TAATCACCTTCAGCTTGGTAGGG + Intergenic
934543628 2:95196455-95196477 TACTCACTTGTAGCTGTGGAAGG + Intergenic
935272323 2:101445544-101445566 ATATAACTATTAGCTGGGCATGG - Intronic
935553641 2:104483706-104483728 TACTCAGTCTTGGCTGGGCACGG + Intergenic
935643505 2:105312819-105312841 TGATGACTTTTGGCCGGGCATGG + Intronic
936393400 2:112097434-112097456 TAAAAACTTTTGGCTGGGCGCGG + Intronic
936951776 2:117984786-117984808 TGCTCACTTACAGCTGGGCATGG + Intronic
937239470 2:120450977-120450999 TAAAAACAATTAGCTGGGCATGG + Intergenic
937400948 2:121583074-121583096 GAAACACCTTTGGCTGGGCACGG - Intronic
937430963 2:121837792-121837814 TAAGCACTTGCAGCTGGGCCAGG - Intergenic
937689228 2:124735938-124735960 AAATGACTTTATGCTGGGCACGG + Intronic
938835766 2:135102723-135102745 TATTCATTTTTGTCTGGGCACGG + Intronic
939045115 2:137240664-137240686 TAAAAAATATTAGCTGGGCATGG - Intronic
939413533 2:141862723-141862745 CAATTATTTTCAGCTGGGCATGG - Intronic
939459182 2:142477170-142477192 AAATAACTTTTGGCTAGGCAAGG + Intergenic
940016829 2:149115227-149115249 AAATCACTGTAGGCTGGGCATGG - Intronic
940119193 2:150244500-150244522 TTATCTCTTTTGGTTGGGCATGG + Intergenic
940232270 2:151468668-151468690 TAAACACTTTCTGTTGGGCATGG - Exonic
940434490 2:153634837-153634859 TAAAGATTTTCAGCTGGGCATGG - Intergenic
940949594 2:159658487-159658509 AAATAAAATTTAGCTGGGCATGG - Intergenic
941214548 2:162689440-162689462 TAATTAAATTTGGCTGGGCAAGG - Intronic
941705499 2:168654385-168654407 AATACAATTTTAGCTGGGCATGG + Intronic
942026950 2:171920292-171920314 TAATCATTTTTGGCTAGGCACGG - Intronic
942120509 2:172771944-172771966 TAATAACTGTTGGCTGGGCATGG + Intronic
942354331 2:175092253-175092275 GATTCACTTTTAACTGGGTATGG + Intronic
943083210 2:183281592-183281614 TAATAAAAATTAGCTGGGCATGG - Intergenic
943744977 2:191452744-191452766 AAATTACTTCTGGCTGGGCATGG + Intergenic
943816462 2:192263539-192263561 AAATAAGTTTTGGCTGGGCATGG + Intergenic
944586821 2:201179954-201179976 TAATGACTCCTGGCTGGGCACGG - Intergenic
944815294 2:203370376-203370398 TCATCTCTCTTTGCTGGGCATGG - Intronic
945081478 2:206090440-206090462 TTAATAATTTTAGCTGGGCATGG - Intergenic
945963622 2:216162555-216162577 TAAACAAAATTAGCTGGGCATGG - Intronic
946529452 2:220556057-220556079 TAATAATAATTAGCTGGGCATGG + Intergenic
946820477 2:223623992-223624014 GTATCACTTTTACCTGGGCCAGG + Intergenic
946836795 2:223780580-223780602 TAAAAAGTATTAGCTGGGCATGG - Intronic
947262403 2:228238372-228238394 TAAAAACTTTTAGCTGGCCGGGG - Intergenic
947430826 2:230026057-230026079 AAAGTACTTTTGGCTGGGCAAGG - Intergenic
947630602 2:231650231-231650253 GAATCACCCTTGGCTGGGCATGG - Intergenic
947693954 2:232166728-232166750 AAATTACTTTGGGCTGGGCACGG + Intronic
948156368 2:235786535-235786557 TAATGAATTATAGTTGGGCATGG + Intronic
948192748 2:236072592-236072614 AAATTAAATTTAGCTGGGCATGG - Intronic
948965219 2:241374299-241374321 AAAGAACTTTTGGCTGGGCACGG - Intronic
1168842627 20:919444-919466 AAATCACTCTGGGCTGGGCATGG - Intergenic
1169089907 20:2853098-2853120 AAACCACTTTCAGCCGGGCATGG + Intronic
1169133310 20:3179471-3179493 TAATAAAAATTAGCTGGGCATGG - Intergenic
1169222696 20:3835199-3835221 AAATTATTTTTGGCTGGGCACGG + Intergenic
1169482546 20:5997757-5997779 AAATCAAAATTAGCTGGGCATGG - Intergenic
1170184719 20:13575919-13575941 TAAAAAATCTTAGCTGGGCACGG + Intronic
1170391992 20:15885183-15885205 TAATCCCTTTTAACTGGACAAGG - Intronic
1170447637 20:16445643-16445665 TCAGCACTTTTAGCAGGGAAAGG + Intronic
1171226693 20:23447611-23447633 CAAAAACATTTAGCTGGGCATGG - Intergenic
1171476278 20:25411506-25411528 TAATCATTTTGGGCTGGACACGG + Intronic
1171497894 20:25570025-25570047 AAAAAAATTTTAGCTGGGCATGG + Intronic
1172258802 20:33543298-33543320 TAATAATTTTTCGCCGGGCACGG - Intronic
1172289437 20:33765532-33765554 TAAACAAAATTAGCTGGGCATGG - Intronic
1172753093 20:37264793-37264815 TAAACAAAATTAGCTGGGCATGG - Intergenic
1172980458 20:38937674-38937696 CAAGTACTTTTGGCTGGGCATGG + Intronic
1173245758 20:41336372-41336394 GAATCACTGTTAGCCTGGCATGG + Intergenic
1173631189 20:44516838-44516860 TATCCTCTCTTAGCTGGGCATGG - Intronic
1173631554 20:44520130-44520152 GAAGAACTTTTGGCTGGGCATGG + Intronic
1173845154 20:46183582-46183604 TAATAATAATTAGCTGGGCATGG - Intronic
1173954794 20:47022808-47022830 TAAACAAAATTAGCTGGGCATGG - Intronic
1174014628 20:47477880-47477902 AATTTACTTTTAGCCGGGCATGG + Intergenic
1174441322 20:50557389-50557411 TAAACATTTTGAGCTGGGCATGG - Intronic
1174580409 20:51567374-51567396 AAATTACAATTAGCTGGGCATGG + Intergenic
1175761949 20:61567233-61567255 TAAGCTCTTCTAGCTGGGGACGG + Intronic
1175989377 20:62780078-62780100 TACCCACATTTGGCTGGGCATGG - Intergenic
1176786082 21:13257977-13257999 AAATTCCTTTTGGCTGGGCATGG - Intergenic
1177984105 21:27951684-27951706 AAATTCCTTTTGGCTGGGCATGG - Intergenic
1178057625 21:28817056-28817078 TAAACACTTCCAGTTGGGCAGGG + Intergenic
1178360668 21:31946700-31946722 TAATCACTTGAACCTGGGAAGGG - Intronic
1178953068 21:37000985-37001007 AAATAACTTTTGGCTGGACATGG + Intergenic
1179136585 21:38684994-38685016 TAATGACTTTTGGCTGGGCGCGG + Intergenic
1179234662 21:39535136-39535158 TAAGAGCATTTAGCTGGGCATGG + Intergenic
1180581399 22:16842223-16842245 TTTTCAGTTTTGGCTGGGCATGG - Intergenic
1180643736 22:17320373-17320395 TAACCCCTTTCAGCTGGGCGTGG + Intergenic
1180663087 22:17486133-17486155 AAAACCCTTTTAGATGGGCACGG - Intronic
1180886442 22:19248004-19248026 TATGAACTTTTGGCTGGGCATGG + Intronic
1181303377 22:21898891-21898913 TAATAAGTATAAGCTGGGCATGG + Intergenic
1181716178 22:24731360-24731382 TAATCACTTATGGCCGGGCATGG + Intronic
1181787148 22:25235628-25235650 TAATTACATTTGGCCGGGCATGG - Intergenic
1181787786 22:25239612-25239634 TAGAAACTTTTGGCTGGGCATGG - Intergenic
1181819143 22:25462236-25462258 TAATTACATTTGGCCGGGCATGG - Intergenic
1181819482 22:25464367-25464389 TAGAAACTTTTGGCTGGGCATGG - Intergenic
1182140661 22:27954694-27954716 TAATAACTTTAGGCTGGGAATGG - Intergenic
1182228914 22:28821526-28821548 CAGTCCCTATTAGCTGGGCATGG - Intergenic
1182238999 22:28899843-28899865 TAAACAAAATTAGCTGGGCATGG - Intronic
1182251156 22:29001758-29001780 TAAAAACTTTTGGCTGGGCGCGG - Intronic
1182290665 22:29276804-29276826 TAAACAAACTTAGCTGGGCATGG - Intronic
1182360361 22:29742945-29742967 TAAAAAATATTAGCTGGGCATGG - Intronic
1182364890 22:29771908-29771930 AAAACATTTTTGGCTGGGCATGG - Intergenic
1182384813 22:29928987-29929009 TGCTCACTTTTGGCTGGGCATGG + Intronic
1182579656 22:31298578-31298600 TAAGCAAGATTAGCTGGGCATGG - Intergenic
1182625059 22:31639516-31639538 TATACACTTTCAGCTAGGCATGG - Intronic
1182786525 22:32912423-32912445 CACTCACTCTTGGCTGGGCACGG + Intronic
1183802768 22:40181786-40181808 TAAACAAAATTAGCTGGGCATGG + Intronic
1183853145 22:40609000-40609022 AAATTACATTTAGTTGGGCATGG + Intronic
1184153480 22:42651674-42651696 TAATAATAATTAGCTGGGCATGG - Intergenic
1184184471 22:42855882-42855904 TAATAACAATTAGCTGGGCGTGG + Intronic
1184258822 22:43302893-43302915 TAATCACATGCAGCTGGGCCTGG - Intronic
1184542454 22:45136056-45136078 TATTGACATTCAGCTGGGCAGGG - Intergenic
1184722181 22:46321246-46321268 CAAAAACATTTAGCTGGGCATGG + Intronic
1184749785 22:46478696-46478718 AAAAAAATTTTAGCTGGGCATGG - Intronic
1185132901 22:49050224-49050246 TATTCACTTTTCCCTGGGCTTGG - Intergenic
1185255792 22:49830188-49830210 TTAAAAATTTTAGCTGGGCATGG + Intergenic
949590615 3:5490627-5490649 GAATCTCCTTTATCTGGGCAAGG - Intergenic
950085614 3:10255302-10255324 GAAACACTGTTGGCTGGGCATGG - Intronic
950365686 3:12482409-12482431 TCATCACTTCTGGCCGGGCACGG - Intergenic
950515502 3:13462302-13462324 TAAAAAAATTTAGCTGGGCATGG + Intergenic
950804259 3:15584297-15584319 AAATCACTCCTGGCTGGGCACGG + Intronic
950816966 3:15714982-15715004 TACTCACTTTTACTTGGTCAAGG - Intronic
951024013 3:17811447-17811469 TGATATCTTTTAGCTGGCCATGG - Intronic
951281783 3:20759470-20759492 TAATAATAATTAGCTGGGCATGG + Intergenic
951669162 3:25161166-25161188 TAATAATAATTAGCTGGGCATGG - Intergenic
952428000 3:33194902-33194924 TAATCACTTTCAGCTGGGCACGG + Intronic
952643660 3:35629482-35629504 TAAAAACTTTAGGCTGGGCATGG + Intergenic
952851686 3:37734780-37734802 TAATAAATGTTGGCTGGGCACGG - Intronic
953234487 3:41094260-41094282 TAATGACTTCCAGCTGGGCGCGG - Intergenic
953272153 3:41456198-41456220 AAAGCACTTTTGGCTGGGCGCGG - Intronic
953600882 3:44363790-44363812 AAATAGCTTATAGCTGGGCATGG + Intronic
953765180 3:45734733-45734755 AAAATACTTTTAGCTGGGCGTGG - Intronic
954055419 3:48019592-48019614 AACTCTCTTTTGGCTGGGCATGG + Intronic
954103581 3:48397007-48397029 TATTTACTTGTGGCTGGGCACGG - Intronic
954775016 3:53009154-53009176 ATACCACTTTTGGCTGGGCACGG + Intronic
955203132 3:56869716-56869738 TAAACTCAATTAGCTGGGCATGG + Intronic
955508232 3:59653363-59653385 TAATAATAATTAGCTGGGCATGG - Intergenic
955600936 3:60644600-60644622 TAATCAAATTTAGAGGGGCAAGG - Intronic
956261407 3:67346918-67346940 TAATAATTTTTAAATGGGCAAGG + Intergenic
956843676 3:73162684-73162706 TAAACTCAATTAGCTGGGCATGG + Intergenic
957027839 3:75204977-75204999 TTAATACTTGTAGCTGGGCATGG + Intergenic
957395080 3:79626154-79626176 TAAAAACTCTCAGCTGGGCATGG + Intronic
957402321 3:79732511-79732533 TAAACACTTTTGGCTGAGAATGG - Intronic
957917956 3:86709870-86709892 TAATTAGTTTTAGCTGTACAGGG + Intergenic
958172309 3:89953520-89953542 TTACTATTTTTAGCTGGGCATGG - Intergenic
959681160 3:109098199-109098221 TAACAAGTTCTAGCTGGGCACGG - Intronic
959762895 3:109989222-109989244 TAATAACTTTAGGCTGGGCGTGG - Intergenic
959919707 3:111857293-111857315 AATTCAATATTAGCTGGGCATGG + Intronic
960013805 3:112862550-112862572 GCTTCACTTTTGGCTGGGCATGG + Intergenic
960269364 3:115657846-115657868 TAAACATTTTTGGCTGGGTACGG - Intronic
960452864 3:117831845-117831867 TCAACACATTGAGCTGGGCATGG + Intergenic
960803908 3:121564536-121564558 TAGTCATTTTTGGCCGGGCATGG - Intergenic
960867908 3:122220681-122220703 TAAGGACTTTGTGCTGGGCATGG + Intronic
960901525 3:122558864-122558886 TAAAAACAATTAGCTGGGCATGG - Intronic
961021274 3:123509226-123509248 CAAAAACTATTAGCTGGGCATGG + Intronic
961395425 3:126584383-126584405 TAAAAAAATTTAGCTGGGCATGG + Intronic
961544798 3:127625185-127625207 TAACAACAGTTAGCTGGGCATGG + Intergenic
961720271 3:128889975-128889997 TAAGAATTATTAGCTGGGCATGG - Intronic
961833359 3:129636716-129636738 TAGTAACTGTTGGCTGGGCATGG + Intergenic
961953918 3:130780584-130780606 ATATCACTATTGGCTGGGCATGG + Intergenic
962030385 3:131593865-131593887 TAATAATAATTAGCTGGGCATGG - Intronic
962226167 3:133611890-133611912 TAAAAACAGTTAGCTGGGCATGG - Intronic
962946704 3:140177637-140177659 TAATAATAATTAGCTGGGCATGG + Intronic
963023630 3:140897384-140897406 TCACCACTGTTAGCAGGGCATGG - Intergenic
963070707 3:141303019-141303041 AGAGCACTTATAGCTGGGCATGG + Intergenic
964192621 3:154022021-154022043 TAAAAAAATTTAGCTGGGCATGG - Intergenic
965028876 3:163337113-163337135 AAATGGCTTTAAGCTGGGCATGG + Intergenic
965669691 3:171134434-171134456 TAATAAAAATTAGCTGGGCATGG - Intronic
966212002 3:177463305-177463327 AAGTCACTATTAGCTAGGCATGG + Intergenic
966485517 3:180465044-180465066 TAATTATTTTTAGCCAGGCACGG + Intergenic
966773602 3:183524973-183524995 AAAAAACTTTTGGCTGGGCATGG + Intronic
966816621 3:183895198-183895220 GAATGACTTGTGGCTGGGCATGG - Intergenic
967044264 3:185722222-185722244 TAAACACTTGCGGCTGGGCATGG - Intronic
967056008 3:185828925-185828947 AAAAAAATTTTAGCTGGGCATGG - Intergenic
967314127 3:188134795-188134817 TTAAAATTTTTAGCTGGGCATGG - Intergenic
967433532 3:189417880-189417902 TAACCACTATTGGCGGGGCACGG + Intergenic
967924862 3:194638146-194638168 TAATCACAACTGGCTGGGCATGG + Intergenic
968020948 3:195388729-195388751 TTAACAATTTGAGCTGGGCATGG + Intronic
968027585 3:195455592-195455614 AAATCAAATTTTGCTGGGCACGG - Intergenic
968178646 3:196573075-196573097 TAATAAAAATTAGCTGGGCATGG - Intronic
970592069 4:17568449-17568471 TAAGAACTTCTAGCTGGGCATGG + Intergenic
971322305 4:25615419-25615441 CAAAGAATTTTAGCTGGGCATGG + Intergenic
971789519 4:31150652-31150674 AACTCAGTTTCAGCTGGGCACGG - Intergenic
972367935 4:38393431-38393453 TAGTTACTTCTGGCTGGGCACGG - Intergenic
973077884 4:45953357-45953379 AAATAAAATTTAGCTGGGCATGG - Intergenic
973213603 4:47643844-47643866 TGATTAGTTTAAGCTGGGCATGG + Intronic
973699271 4:53520669-53520691 TGTTTACTTTTGGCTGGGCATGG + Intronic
973726656 4:53783767-53783789 TAATAAAAATTAGCTGGGCATGG - Intronic
973761567 4:54121144-54121166 TAAGAACTTTTAGCCAGGCACGG - Intronic
973763039 4:54138305-54138327 GAATTAATTTTAGCTGGGCTGGG - Intronic
973903894 4:55507157-55507179 TAAACAAAGTTAGCTGGGCATGG + Intronic
974034225 4:56803268-56803290 TAAAAAGTGTTAGCTGGGCATGG + Intergenic
974532584 4:63129019-63129041 TAAATACTTTGGGCTGGGCACGG + Intergenic
976201319 4:82581749-82581771 TATCTACTTTTGGCTGGGCATGG - Intergenic
976206047 4:82624544-82624566 TATTCACTGTTGGCTGGGCATGG + Intergenic
976315120 4:83651804-83651826 AATACCCTTTTAGCTGGGCATGG + Intergenic
976344032 4:83979274-83979296 TCATATCTTTTGGCTGGGCACGG + Intergenic
976904902 4:90225364-90225386 AAGTCACTTTAGGCTGGGCATGG - Intronic
977253752 4:94717528-94717550 GAATAACTTTCGGCTGGGCATGG + Intergenic
977686601 4:99853661-99853683 TAAAAAATATTAGCTGGGCATGG + Intronic
977743232 4:100512648-100512670 TAAAAAAATTTAGCTGGGCATGG + Intronic
977757487 4:100690374-100690396 TAATAAATTGCAGCTGGGCATGG + Intronic
977836503 4:101651691-101651713 TAATCTTTTTTGGCTGGGCGTGG - Intronic
978209422 4:106117717-106117739 TAAACACTTTAGGCTGGGCGCGG + Intronic
978388732 4:108202597-108202619 TAAAAACATTTAGCCGGGCACGG + Intergenic
978558757 4:110009387-110009409 TATGCACTTTTAGCTGCTCAAGG - Intronic
979306106 4:119145490-119145512 CACACAGTTTTAGCTGGGCATGG - Intronic
979494049 4:121364344-121364366 TAAAAACTTTTGGCTGGGCATGG + Intronic
979781392 4:124654729-124654751 TAACCACTGTTTGCTGGGCACGG - Intergenic
980113017 4:128652703-128652725 AAATTATTTTTGGCTGGGCACGG - Intergenic
980154119 4:129083499-129083521 AAATCACTTTTGGCCAGGCATGG + Intronic
980476601 4:133325964-133325986 TAAGAGATTTTAGCTGGGCATGG - Intergenic
980508941 4:133759891-133759913 TAAAAAATATTAGCTGGGCATGG + Intergenic
980518621 4:133900641-133900663 TAATCACTTTTAGCAAGTTATGG + Intergenic
980579877 4:134735411-134735433 AAAAAATTTTTAGCTGGGCATGG - Intergenic
980917602 4:139048567-139048589 TAAAAAATTTTAGCTGGGCATGG - Intronic
981125093 4:141096486-141096508 TAAAAACTCTTGGCTGGGCACGG - Intronic
981690175 4:147499344-147499366 TAATGACTTCAGGCTGGGCATGG - Intronic
981973340 4:150692508-150692530 TAAAAACTTCTTGCTGGGCATGG - Intronic
982005363 4:151058106-151058128 CCAGCACTTTTAGCTGGGCATGG + Intergenic
982014816 4:151142945-151142967 GACTAACTTTTGGCTGGGCATGG + Intronic
982022972 4:151222826-151222848 TACTAACAATTAGCTGGGCATGG - Intronic
982035284 4:151339997-151340019 TGACCTCTTTTGGCTGGGCATGG + Intergenic
982437347 4:155394436-155394458 TAAACAAAATTAGCTGGGCATGG - Intergenic
982716028 4:158809164-158809186 TAGTGACTCTTTGCTGGGCATGG + Intronic
983267049 4:165518294-165518316 TAATAATAATTAGCTGGGCATGG - Intergenic
983591452 4:169416611-169416633 TAAGCACATGTGGCTGGGCATGG + Intronic
983710436 4:170708949-170708971 TAAACAAAGTTAGCTGGGCATGG + Intergenic
983810635 4:172057115-172057137 TAATTGTTTTTGGCTGGGCATGG + Intronic
984683035 4:182633083-182633105 TAAAAACAATTAGCTGGGCATGG - Intronic
984776757 4:183488116-183488138 TAAACATTTTTGGCTGGGCGCGG + Intergenic
984836365 4:184025742-184025764 TAAAAACAATTAGCTGGGCATGG - Intergenic
986177129 5:5362176-5362198 TAAAAACAGTTAGCTGGGCATGG + Intergenic
986722965 5:10573176-10573198 TAATCTCTTCCAGCTGGGCGCGG + Intronic
986884525 5:12216822-12216844 TACAAACATTTAGCTGGGCATGG + Intergenic
987236989 5:15952621-15952643 TAATTACTTTTGGCTGGGTACGG + Intergenic
987536552 5:19196770-19196792 TGATCACTTTTACCTTGGAAAGG - Intergenic
987828549 5:23064680-23064702 AAATCATTTTTAGCTGGAGAGGG - Intergenic
988098197 5:26644977-26644999 TTATCTTTTTTGGCTGGGCATGG + Intergenic
988116810 5:26904303-26904325 TAATATCTTTTAGTGGGGCATGG + Intronic
988530140 5:32020294-32020316 TATTCTATTTTGGCTGGGCATGG - Intronic
988677666 5:33449743-33449765 GAATCATTTTTGGCTGGGCGCGG - Intronic
988788791 5:34588401-34588423 TAAAAACAATTAGCTGGGCATGG - Intergenic
989055742 5:37364924-37364946 TAAACATTTCCAGCTGGGCACGG - Intronic
989360452 5:40595636-40595658 CATTCACTTTAGGCTGGGCATGG - Intergenic
989429631 5:41337476-41337498 TAATCACTCTTATCTTGGAAAGG - Intronic
989609298 5:43276181-43276203 TACTCAATTTTGGCTGGGCGCGG - Intronic
989764917 5:45071009-45071031 GAAACCCTATTAGCTGGGCATGG + Intergenic
990048339 5:51462522-51462544 GAATCATTTAGAGCTGGGCATGG - Intergenic
990101971 5:52202022-52202044 GTATTACTTTTGGCTGGGCACGG - Intergenic
990705454 5:58523889-58523911 GAATGATTATTAGCTGGGCATGG - Intergenic
991061403 5:62380182-62380204 TAATAAATTCCAGCTGGGCATGG - Intronic
991313363 5:65271097-65271119 TAATTATATTTGGCTGGGCACGG + Intronic
991318335 5:65338448-65338470 TAGTCACTTTTGCCTAGGCATGG + Intronic
991386495 5:66096032-66096054 TGTTCATTTTTGGCTGGGCATGG + Intergenic
991773471 5:70061361-70061383 AAACCAAATTTAGCTGGGCATGG - Intronic
991852765 5:70936785-70936807 AAACCAAATTTAGCTGGGCATGG - Intronic
991901492 5:71465005-71465027 TAAAAACTTTAGGCTGGGCATGG - Intronic
992065335 5:73102607-73102629 TATTTTCTTTTGGCTGGGCACGG + Intergenic
992133353 5:73718032-73718054 AAATCAGAATTAGCTGGGCATGG - Intronic
992234818 5:74698362-74698384 TAATAATTTTTGGCTGGGCACGG - Intronic
992697544 5:79305159-79305181 TGATCATTTTAGGCTGGGCATGG + Intronic
993372172 5:87106237-87106259 TACTAACTTTTAGGTGGTCAAGG - Intergenic
994212080 5:97098592-97098614 AAAAAGCTTTTAGCTGGGCACGG + Intronic
994820702 5:104647506-104647528 TCAACACTTTCATCTGGGCAAGG + Intergenic
995084373 5:108090117-108090139 CATTCAATTTTGGCTGGGCATGG - Intronic
995359303 5:111276434-111276456 TAAATAATTTTTGCTGGGCATGG + Intronic
995392171 5:111651598-111651620 ACATCACTTTGGGCTGGGCATGG + Intergenic
995590637 5:113696206-113696228 TTACCACTTTCAGCTGGACATGG + Intergenic
996868089 5:128153262-128153284 TTATCTTTTTTGGCTGGGCACGG + Intronic
997074532 5:130656939-130656961 TTATCATTTTTAGCTTGTCAAGG - Intergenic
997322498 5:132990030-132990052 TAATAACTTTAGGCTGGGCTCGG - Intergenic
997323410 5:132999211-132999233 AAATCGCTTTTGGCTGGGCGCGG - Intronic
998430699 5:142067442-142067464 TAAAAAATATTAGCTGGGCATGG + Intergenic
998433892 5:142090316-142090338 TAAGAAATTTAAGCTGGGCATGG - Intergenic
999521354 5:152353746-152353768 TAATCCCTTTTTGTTGGACAGGG - Intergenic
999593061 5:153170405-153170427 TAATTACTGTAAGCTGGGCCTGG - Intergenic
999729277 5:154463638-154463660 CAAAAACATTTAGCTGGGCATGG + Intergenic
1000334672 5:160233268-160233290 AAAGCACTTATGGCTGGGCACGG - Intronic
1000851075 5:166340972-166340994 AAATAACTTTGAGCTGGGCATGG + Intergenic
1000868364 5:166543417-166543439 TTATAAATTGTAGCTGGGCATGG + Intergenic
1001374580 5:171244099-171244121 TAAAAGATTTTAGCTGGGCACGG + Intronic
1001606917 5:172967172-172967194 TAAGCTCTTGTGGCTGGGCATGG + Intronic
1001619532 5:173071763-173071785 TAATTATTTTAGGCTGGGCATGG + Intronic
1001916426 5:175564461-175564483 AAAACACTTGAAGCTGGGCATGG - Intergenic
1002557541 5:180055350-180055372 AACTTACTTCTAGCTGGGCATGG - Intronic
1002603981 5:180371170-180371192 AAATCCCTTTTAGCTGGGAGGGG - Intergenic
1003878967 6:10463215-10463237 TAAACAAAATTAGCTGGGCATGG + Intergenic
1003955683 6:11163135-11163157 TAAAAAATTTTGGCTGGGCATGG + Intergenic
1004433199 6:15564948-15564970 TAAACAAAATTAGCTGGGCATGG + Intronic
1004571850 6:16853785-16853807 AAAACAGTTTTGGCTGGGCATGG + Intergenic
1004679570 6:17880109-17880131 AAATAACAATTAGCTGGGCATGG - Intronic
1005325601 6:24697062-24697084 TTATGATTTTTGGCTGGGCACGG - Intronic
1005452022 6:25982793-25982815 AAATAACTTGTGGCTGGGCATGG + Intronic
1005976058 6:30800612-30800634 TGATAAATTTTGGCTGGGCATGG - Intergenic
1006571428 6:35008370-35008392 AAAACACTTTTAGCTGGGCATGG - Intronic
1006585208 6:35105853-35105875 TAGTCACTCCTGGCTGGGCATGG - Intergenic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1010228510 6:73514150-73514172 TAATAAAAATTAGCTGGGCATGG - Intergenic
1010390247 6:75328776-75328798 AAAACATTATTAGCTGGGCACGG - Intronic
1010392552 6:75354280-75354302 TTAAAACTTTTAGCTGGGCGTGG + Intronic
1010664537 6:78613052-78613074 TACTCTCTTTTAGTTGGACATGG - Intergenic
1010970938 6:82262814-82262836 AAATAACTTACAGCTGGGCATGG + Intergenic
1011021832 6:82822486-82822508 TAAACAAAATTAGCTGGGCATGG + Intergenic
1011404780 6:87007643-87007665 TAAACTCTTCTGGCTGGGCATGG + Intronic
1011475714 6:87749032-87749054 AAATCTCTTTTGGCTGGGCACGG + Intergenic
1012029822 6:94044791-94044813 AATTCACTTTTAGCTGACCAAGG + Intergenic
1012120230 6:95356607-95356629 TGAGGATTTTTAGCTGGGCATGG + Intergenic
1012898543 6:104979496-104979518 AAATCATCTTTGGCTGGGCACGG - Intronic
1013120280 6:107134781-107134803 TTACCACTGGTAGCTGGGCACGG + Intergenic
1013926853 6:115483298-115483320 AAATAATTTTTGGCTGGGCACGG + Intergenic
1014240423 6:119012057-119012079 TAATAACGTCTAGCTTGGCAGGG + Intronic
1015114522 6:129633135-129633157 TAGTAACTTTTGGCTGGGCATGG + Intronic
1015187380 6:130433426-130433448 AAATCATTTTTGGCTGGGCGTGG - Intronic
1015337286 6:132054309-132054331 AAATCATATTTCGCTGGGCATGG - Intergenic
1016310783 6:142731306-142731328 TGATGAGGTTTAGCTGGGCATGG + Intergenic
1016390791 6:143572841-143572863 AAACCACTGTTGGCTGGGCACGG - Intronic
1016637354 6:146309106-146309128 TAAACATTTCTGGCTGGGCATGG + Intronic
1016950461 6:149574597-149574619 TTAGTACTTTTGGCTGGGCATGG + Intronic
1016950966 6:149579398-149579420 TAGTAATTGTTAGCTGGGCATGG + Intronic
1017423552 6:154297328-154297350 TAATGACTTTGGGCTGGGCGCGG - Intronic
1017566081 6:155688257-155688279 TAATAATAATTAGCTGGGCATGG - Intergenic
1017886952 6:158607512-158607534 AAATAAAATTTAGCTGGGCATGG + Intronic
1017990087 6:159479724-159479746 TTATGACTGTAAGCTGGGCAGGG - Intergenic
1018590007 6:165409254-165409276 TAATCAGCTTTGGCTGGGCGAGG + Intronic
1018666380 6:166141994-166142016 TTAAAACTTTCAGCTGGGCATGG + Intergenic
1019782918 7:2954837-2954859 TTATCTCATTTGGCTGGGCATGG + Intronic
1019939767 7:4280338-4280360 TATTCACTCTGGGCTGGGCACGG - Intergenic
1020030825 7:4931582-4931604 TAAAAAGTATTAGCTGGGCATGG - Intronic
1021779820 7:24092788-24092810 TTATAACATTGAGCTGGGCAAGG - Intergenic
1021922727 7:25502853-25502875 CAACCACATGTAGCTGGGCATGG - Intergenic
1021985999 7:26099164-26099186 TAAAAATTATTAGCTGGGCATGG - Intergenic
1022146997 7:27554274-27554296 AAATGACTTTTGGCTGGGCGCGG - Intronic
1022203517 7:28140371-28140393 TTGTGACTTTTGGCTGGGCATGG - Intronic
1022434113 7:30362825-30362847 GAATCACTTGAGGCTGGGCATGG + Intronic
1022638833 7:32162334-32162356 GCATCACTTCTAGCTTGGCACGG - Intronic
1023577598 7:41645874-41645896 TAAAAACAATTAGCTGGGCATGG - Intergenic
1023577645 7:41646228-41646250 TGATTATTCTTAGCTGGGCATGG - Intergenic
1023630536 7:42159473-42159495 TAATCATCTTTAGTTGGGAAGGG - Intronic
1023808758 7:43894506-43894528 TAATAATAATTAGCTGGGCATGG - Intronic
1023815359 7:43945281-43945303 TAACCACTGTTGGCTGGGCACGG - Intronic
1024653007 7:51424759-51424781 TAAATATTTTTGGCTGGGCATGG - Intergenic
1025096971 7:56103582-56103604 TTTTCACTTTTGGCTGGGAACGG - Intronic
1025208459 7:57007396-57007418 TAATCAAAATTAGCCGGGCATGG + Intergenic
1025786049 7:64644212-64644234 TCTTCTCTTTTACCTGGGCATGG + Intergenic
1026101363 7:67387112-67387134 TAATAAAAATTAGCTGGGCATGG + Intergenic
1026309393 7:69170696-69170718 TAATGCCATTTGGCTGGGCATGG - Intergenic
1026659100 7:72283377-72283399 TAAAAAAATTTAGCTGGGCATGG + Intronic
1026859639 7:73777494-73777516 TAAAAATTATTAGCTGGGCATGG - Intergenic
1027020561 7:74810508-74810530 TATAAACTTTCAGCTGGGCATGG + Intronic
1027067464 7:75135422-75135444 TATAAACTTTCAGCTGGGCATGG - Intronic
1027377606 7:77568485-77568507 TAATAATAATTAGCTGGGCATGG + Intronic
1027493092 7:78855240-78855262 TAAAAAATTTTAGCTGGGCATGG - Intronic
1028153443 7:87402709-87402731 TAACCACTATCAGCCGGGCAAGG + Intronic
1029253906 7:99255951-99255973 GAGTCACTTCTAGCTGGGCTGGG - Intergenic
1029357238 7:100061229-100061251 TGTTAACTTTTGGCTGGGCATGG + Intronic
1029408320 7:100391198-100391220 TTATTATTATTAGCTGGGCATGG + Intronic
1029462226 7:100702083-100702105 TCTTCGCCTTTAGCTGGGCATGG + Intergenic
1030074972 7:105729113-105729135 TAATAATAATTAGCTGGGCATGG + Intronic
1030097275 7:105911511-105911533 TGGTCAGTTTTGGCTGGGCACGG + Intronic
1030201578 7:106910980-106911002 AAATCACTATTTGCTGGGCACGG - Intergenic
1031194850 7:118600487-118600509 TAACAACTTCTGGCTGGGCATGG + Intergenic
1031890791 7:127291268-127291290 TAAAAAATTTTAGTTGGGCATGG - Intergenic
1031980959 7:128123963-128123985 CAATCAGTATTAGCTGGGCATGG - Intergenic
1031998999 7:128252575-128252597 TAAAAAATGTTAGCTGGGCATGG + Intronic
1032148986 7:129411467-129411489 GAATCATTTATGGCTGGGCACGG + Intronic
1032208153 7:129887508-129887530 GTATCACCTTTAGCTGGGCGTGG - Intronic
1032397071 7:131598119-131598141 AAAGCCCCTTTAGCTGGGCATGG - Intergenic
1032844586 7:135741666-135741688 TAAAAAAATTTAGCTGGGCATGG + Intronic
1033125655 7:138704923-138704945 TAAAAAATATTAGCTGGGCATGG + Intergenic
1033202168 7:139382681-139382703 TAATTACTTTAGGTTGGGCATGG - Intronic
1034146323 7:148876006-148876028 TAATAAATGTTAGCTGGGCATGG + Intronic
1034986574 7:155519363-155519385 TAAACAAAATTAGCTGGGCATGG + Intronic
1035092499 7:156325990-156326012 TAATAACTCCTGGCTGGGCATGG + Intergenic
1035186892 7:157133400-157133422 AAAAAACTTTTAGCTGGGCATGG - Intergenic
1035358334 7:158293284-158293306 TAGTAACTTTGGGCTGGGCACGG + Intronic
1035878541 8:3218579-3218601 AAATTATTTTTGGCTGGGCACGG + Intronic
1036371182 8:8164199-8164221 TAATAATAATTAGCTGGGCATGG + Intergenic
1036811992 8:11873457-11873479 AAATAAATATTAGCTGGGCATGG - Intergenic
1036879719 8:12501449-12501471 TAATAATAATTAGCTGGGCATGG - Intergenic
1037634206 8:20686270-20686292 TAAACACTGTTGGCTGGGCATGG + Intergenic
1037800289 8:22030391-22030413 TAATAAACATTAGCTGGGCATGG - Intronic
1037873075 8:22518215-22518237 TAAAAACAATTAGCTGGGCATGG - Intronic
1037997327 8:23362576-23362598 TCAAAACATTTAGCTGGGCATGG + Intronic
1038716150 8:29992995-29993017 TGCTCACATTTAGCTGGGCATGG - Intergenic
1038801488 8:30753545-30753567 TGGTCAGTTTTGGCTGGGCATGG - Intronic
1038879437 8:31591463-31591485 TAATCAGTCTTGGTTGGGCATGG - Intergenic
1039056995 8:33544975-33544997 TAATCAAAATTGGCTGGGCATGG + Intergenic
1039979859 8:42400045-42400067 TAATTCCTTTTGGCTGGGCGTGG + Intronic
1039985413 8:42443618-42443640 TATGCATTTTTGGCTGGGCATGG - Intronic
1040098676 8:43476689-43476711 TAGTAACTTTAGGCTGGGCATGG + Intergenic
1041047719 8:53903015-53903037 CAATCATTTTGGGCTGGGCACGG - Intronic
1041079611 8:54203679-54203701 TAAAAAATATTAGCTGGGCATGG + Intergenic
1041435055 8:57830180-57830202 CAACTAATTTTAGCTGGGCATGG + Intergenic
1041576307 8:59399725-59399747 TAAAAAATATTAGCTGGGCATGG + Intergenic
1041638541 8:60171698-60171720 TAAAAACAATTAGCTGGGCATGG - Intergenic
1041685335 8:60639335-60639357 TTATCACTTCTGGCCGGGCATGG - Intergenic
1042152171 8:65799677-65799699 TATTCACTCATGGCTGGGCATGG + Intronic
1042335300 8:67623767-67623789 AAAGCTCTTTTGGCTGGGCACGG + Intronic
1042379142 8:68092942-68092964 TAATCAAATGTGGCTGGGCATGG - Intronic
1043153910 8:76753778-76753800 TAATCATAATTAGCTGAGCATGG - Intronic
1043309749 8:78843522-78843544 AAATTAGTTTCAGCTGGGCAAGG + Intergenic
1043475847 8:80605571-80605593 TACTACCTTTTGGCTGGGCATGG - Intergenic
1043916299 8:85926481-85926503 AAATCATTGTCAGCTGGGCATGG - Intergenic
1044110278 8:88264489-88264511 TATGGACTTGTAGCTGGGCATGG - Intronic
1044603975 8:94033027-94033049 TAAACAAAATTAGCTGGGCATGG - Intergenic
1044685003 8:94818214-94818236 TAAAAAATTTCAGCTGGGCACGG - Intronic
1045156615 8:99481982-99482004 TAATCACTTTTAGCAGCTTATGG + Intronic
1045500579 8:102741534-102741556 TGACCTCCTTTAGCTGGGCATGG + Intergenic
1045655895 8:104386240-104386262 TAATCATATTGGGCTGGGCATGG + Intronic
1046566424 8:115906990-115907012 TAAGAATTCTTAGCTGGGCATGG + Intergenic
1046624021 8:116558264-116558286 CAATAAATTTTAGCTAGGCATGG + Intergenic
1047012227 8:120684944-120684966 GATTCAATTTTTGCTGGGCATGG - Intronic
1047113464 8:121816340-121816362 TAAACACTGTTGGCTGGGCGCGG + Intergenic
1047115495 8:121837395-121837417 TAATTAGTATTAGCTGGGCGCGG + Intergenic
1047678218 8:127226077-127226099 TAATTAAAATTAGCTGGGCATGG + Intergenic
1048163558 8:132041964-132041986 TAATCACTCTCAGCTGGTCATGG + Intronic
1048242473 8:132756877-132756899 AAATCATTCTTCGCTGGGCATGG - Intronic
1048832572 8:138490983-138491005 AAATCAAAATTAGCTGGGCATGG + Intronic
1049580882 8:143410145-143410167 TAAACAATATTAGCTGGGCATGG - Intergenic
1049991666 9:997455-997477 AAAACACTTCTAGCTGGGCGCGG + Intergenic
1050435180 9:5601150-5601172 TAATTAATTTTGGCTGGGCGTGG - Intergenic
1050511152 9:6397208-6397230 GAAACACTTCTGGCTGGGCACGG + Intergenic
1050769172 9:9175330-9175352 TAATAATTCTTGGCTGGGCACGG + Intronic
1051403932 9:16713781-16713803 TACTCAATTTTGGCTGGGCGTGG + Intronic
1051426272 9:16934748-16934770 TATTCACTTTGGGCTGGGCGTGG - Intergenic
1051433346 9:17003391-17003413 CAATCTTTATTAGCTGGGCATGG + Intergenic
1051649914 9:19312391-19312413 TAATAATTTGTAGCCGGGCATGG - Intronic
1052495936 9:29224153-29224175 TAGTTACATTTGGCTGGGCACGG - Intergenic
1052844646 9:33324393-33324415 TAATTAAATTTAGCTGGGCATGG + Intronic
1052942328 9:34139418-34139440 ACATCATTTTTGGCTGGGCATGG + Intergenic
1052943498 9:34148841-34148863 AAAAAAATTTTAGCTGGGCATGG - Intergenic
1052964122 9:34326194-34326216 TAAACAAAATTAGCTGGGCATGG + Intronic
1053220683 9:36310148-36310170 TTTTAACTTTTAGGTGGGCATGG + Intergenic
1053334041 9:37247758-37247780 TAAAAACAATTAGCTGGGCATGG + Intronic
1054780714 9:69163766-69163788 TAATTATTTGCAGCTGGGCATGG - Intronic
1055018312 9:71643047-71643069 GAAACACTTGTGGCTGGGCACGG + Intergenic
1055127161 9:72732270-72732292 TAATAAATATCAGCTGGGCAAGG + Intronic
1055378161 9:75673550-75673572 TAAAAAAGTTTAGCTGGGCATGG - Intergenic
1055382433 9:75723869-75723891 TAACCTATTTTGGCTGGGCATGG + Intergenic
1056506773 9:87265099-87265121 TATTAACTTGTGGCTGGGCATGG - Intergenic
1057145650 9:92757537-92757559 TATTTTCTATTAGCTGGGCATGG + Intronic
1058200769 9:102036998-102037020 TAATTACTTTTTGCAGGGGATGG - Intergenic
1058245545 9:102620017-102620039 TAATCATGTTTATCTGGACATGG - Intergenic
1058378858 9:104356984-104357006 TATTCATTTCCAGCTGGGCATGG + Intergenic
1058618179 9:106858296-106858318 TAGTCACTTTTCCCTAGGCATGG + Intergenic
1058742582 9:107958719-107958741 TATTCAATTTGAGCTGGGCATGG + Intergenic
1059006131 9:110404868-110404890 TAAACAAAATTAGCTGGGCACGG + Intronic
1059243529 9:112829425-112829447 TAAAAACAATTAGCTGGGCATGG - Intronic
1060092508 9:120755763-120755785 AAATAACAATTAGCTGGGCATGG + Intronic
1061295220 9:129673299-129673321 TAAAAACAATTAGCTGGGCATGG + Intronic
1061534996 9:131242124-131242146 AAATCAAAGTTAGCTGGGCATGG + Intergenic
1062381265 9:136287984-136288006 TAAAAAATTATAGCTGGGCATGG - Intronic
1062670639 9:137706910-137706932 GAATCACTTTAACCTGGGCGGGG - Intronic
1185487762 X:496314-496336 AAATCACTTTGGGCTGGGCACGG - Intergenic
1186010963 X:5132467-5132489 TATTCACTTTTAGGTGGCAATGG + Intergenic
1186703778 X:12120400-12120422 TACTAACTATAAGCTGGGCAGGG + Intergenic
1186754311 X:12654059-12654081 TAATGGTTTTTGGCTGGGCACGG - Intronic
1186817018 X:13248104-13248126 TAAACAAAATTAGCTGGGCATGG + Intergenic
1187287759 X:17922476-17922498 TAATCAATTTGAGTTGGGCAAGG + Intergenic
1187333401 X:18361249-18361271 TAAACATTTCTGGCTGGGCACGG + Intergenic
1187335907 X:18381518-18381540 AAATCACTTTAGGTTGGGCATGG - Intergenic
1187441703 X:19326635-19326657 TTAACACTTCCAGCTGGGCAAGG - Intergenic
1187577367 X:20572088-20572110 TACTATTTTTTAGCTGGGCATGG + Intergenic
1187662096 X:21560031-21560053 TCATAAAATTTAGCTGGGCAAGG + Intronic
1187859203 X:23665664-23665686 GGATCACAATTAGCTGGGCATGG + Intronic
1188580845 X:31711307-31711329 TAATAACTTTTAGATGGGAGGGG - Intronic
1189258899 X:39663348-39663370 TAATAATTTATGGCTGGGCACGG + Intergenic
1189432205 X:40957667-40957689 TAATAATAATTAGCTGGGCATGG + Intergenic
1189806001 X:44736334-44736356 TTATCATTTTAGGCTGGGCATGG - Intergenic
1189922501 X:45916121-45916143 TAAACAAAATTAGCTGGGCATGG - Intergenic
1190057980 X:47193137-47193159 TAATCCCTATTTGCTGGGCAGGG + Intronic
1190460329 X:50666997-50667019 CAATCATTTTTAGCTGAACAAGG + Intronic
1190533299 X:51402497-51402519 TACACAAATTTAGCTGGGCATGG + Intergenic
1190629750 X:52374521-52374543 TATTCACTTTCAGCTGGGCGTGG - Intronic
1190749167 X:53346050-53346072 TAACCACTTCCAGCTGGGTAAGG + Intergenic
1192019147 X:67366305-67366327 TAGTCCATTTTGGCTGGGCACGG + Intergenic
1192462072 X:71325440-71325462 AAATCATTTTAGGCTGGGCATGG - Intergenic
1192872746 X:75200301-75200323 TATTCTTTTTTGGCTGGGCATGG + Intergenic
1193097090 X:77562698-77562720 TAAATACAATTAGCTGGGCATGG - Intronic
1193115361 X:77770390-77770412 TTATCATTTTTGGCCGGGCATGG - Intronic
1193987907 X:88269271-88269293 TAAACAATGTTAGCTGGGCATGG + Intergenic
1194007847 X:88519143-88519165 TAATCTCTTCAAGCTGTGCAGGG + Intergenic
1195857795 X:109349522-109349544 CAAAAACATTTAGCTGGGCATGG - Intergenic
1195907152 X:109855429-109855451 TAGTGACGTTTGGCTGGGCAAGG - Intergenic
1196107317 X:111910825-111910847 CAATAACTATTAGCTGGGCGGGG - Intronic
1196382577 X:115108304-115108326 TAATCACAATTGGCTGGGCGTGG + Intergenic
1196414488 X:115456085-115456107 GAATCTCTGTTGGCTGGGCACGG - Intergenic
1196843417 X:119879498-119879520 TAATCCTTTTTGGCTGGGCATGG + Intergenic
1197194918 X:123689708-123689730 AAATGATTTTCAGCTGGGCATGG - Intronic
1197246157 X:124169107-124169129 AAAAAACTTTTGGCTGGGCACGG + Intronic
1198036932 X:132810113-132810135 GTATCACTTTAGGCTGGGCATGG + Intronic
1198177367 X:134170256-134170278 TAAGCACTTTTACATGGCCAAGG + Intergenic
1198383972 X:136110122-136110144 AAAACACAATTAGCTGGGCATGG + Intergenic
1198717993 X:139582903-139582925 TAATTAATGTTAGCTGGGGATGG - Intronic
1200808399 Y:7456784-7456806 AAATCATTTTAGGCTGGGCATGG - Intergenic
1200900124 Y:8423022-8423044 TACACACAATTAGCTGGGCATGG - Intergenic
1201330560 Y:12815514-12815536 TAAAAACTTCTAGCCGGGCATGG - Intronic
1201857461 Y:18560791-18560813 TAATTACTTGTGGCTGGGCATGG + Intronic
1201875860 Y:18759589-18759611 TAATTACTTGTGGCTGGGCATGG - Intronic