ID: 1159993995

View in Genome Browser
Species Human (GRCh38)
Location 18:74943910-74943932
Sequence CATAATTTGTAGAAATTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159993995_1159993997 13 Left 1159993995 18:74943910-74943932 CCTTCGAATTTCTACAAATTATG 0: 1
1: 0
2: 0
3: 7
4: 158
Right 1159993997 18:74943946-74943968 GTATCTCATCCAAAAGAATGTGG 0: 1
1: 0
2: 0
3: 22
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159993995 Original CRISPR CATAATTTGTAGAAATTCGA AGG (reversed) Intronic
900536868 1:3182974-3182996 CATCATTTCTAGAATTTCTATGG - Intronic
901113136 1:6815552-6815574 GATAATTAGTAGAAACTCTAGGG - Intronic
902054286 1:13587451-13587473 TATAACTTGTGGAAATACGACGG + Intronic
905845354 1:41226308-41226330 CATCATTTGTGGAAATTCTAGGG - Intronic
905989524 1:42322490-42322512 CTTAATTTGTTGAATCTCGATGG + Intronic
906229029 1:44144924-44144946 AATATTTTGTAGAAGTTTGAAGG - Intergenic
908016946 1:59851471-59851493 GCTAATATGTAGAAATTTGATGG + Intronic
908913888 1:69103848-69103870 CATCATTTTTAGACATTCGTAGG - Intergenic
915933713 1:160077542-160077564 AAAAATTTGTATAAATTCAAGGG - Intergenic
917122776 1:171659044-171659066 CATAATATTTAGAAATTAGATGG - Intergenic
919032456 1:192260514-192260536 CATAATTTCAAGAAAATTGAAGG + Intergenic
919292441 1:195649718-195649740 CATAATTTGGAGAAAATATAAGG + Intergenic
919350709 1:196450425-196450447 CATAACTTTTAGAAATACAAGGG - Intronic
919359048 1:196567475-196567497 CATAATTTTTAGAAACAGGATGG + Intronic
921164271 1:212494896-212494918 TATAATTAGTAGGAATTAGAAGG + Intergenic
922453713 1:225757406-225757428 CATAATTTTGATAAATTCTAAGG - Intergenic
923347786 1:233073161-233073183 CCTAATTTGTTGAAATACAAGGG + Intronic
924919104 1:248607480-248607502 CATAATTTGCATAAATTGAACGG - Intergenic
1064986307 10:21213806-21213828 TATAATGTGTAGATATTCGTTGG - Intergenic
1068670482 10:59717354-59717376 CATAAATTGGAGAACTTGGAAGG + Intronic
1074026506 10:109641315-109641337 CATCATTTGTAGGAAATGGAAGG + Intergenic
1074142646 10:110688083-110688105 GATAATTTTTAGAAATTTGGTGG + Intronic
1076466136 10:130683025-130683047 CATAAATTGTATAAGTTCCAGGG - Intergenic
1078025064 11:7687353-7687375 CATAATTTTGAGAAAATTGAAGG + Intergenic
1079751853 11:24209761-24209783 CTTTATTTGTAGAATTTCAAGGG - Intergenic
1084244075 11:67843833-67843855 CATAAATTGTAAAGATTCCATGG - Intergenic
1086575489 11:88335410-88335432 AATAATTTTTAAAAATTCGCTGG + Intronic
1087892058 11:103546700-103546722 CCTAATCTGTACAAATTAGAGGG - Intergenic
1091176891 11:133566963-133566985 AATAATTTGTCGAAATCCCAAGG - Intergenic
1092032610 12:5300682-5300704 CAGAATTTGTAGCACTTGGAAGG - Intergenic
1093325015 12:17763035-17763057 AATAATTTTTAGAAATCCTAGGG - Intergenic
1094292324 12:28865805-28865827 CTTAATTTAAAAAAATTCGAGGG - Intergenic
1095120685 12:38414629-38414651 TATAAAATTTAGAAATTCGAGGG - Intergenic
1096999507 12:55864419-55864441 CAAAATTGGTTGAAATTGGATGG - Intergenic
1097446723 12:59680358-59680380 CATAATTCCTATAAATTCCAAGG - Intronic
1097947270 12:65384145-65384167 TTTATTTTGTAGAAATTCAAAGG + Intronic
1099571742 12:84329727-84329749 AATAATTTCCAGAAATACGAAGG - Intergenic
1099920493 12:88951538-88951560 GATATTTTCTAGAAATTCAAAGG - Intergenic
1100908495 12:99330975-99330997 CATCATTTTTATACATTCGAGGG + Intronic
1104190408 12:126476955-126476977 CTTAATTTGTATAAATTTAAGGG - Intergenic
1105423052 13:20270158-20270180 CCAAATTTGTAGAAACTCAAAGG - Intergenic
1105786556 13:23755842-23755864 CATATTTTCAAGAAATTCCAAGG - Intronic
1106468922 13:30037609-30037631 AATAGATTGTAGAAATTCAAAGG - Intergenic
1106595468 13:31131765-31131787 CATAACTTGTAGAACTTCCTGGG + Intergenic
1109081953 13:57914847-57914869 CATGATAAGTAGAAATTTGAGGG + Intergenic
1109513639 13:63412290-63412312 CATATTTTGTAAAAATTGGAAGG + Intergenic
1110078298 13:71278031-71278053 CATAGTTATTAGAAATTCCAAGG - Intergenic
1110430763 13:75420403-75420425 CATAATTTTTAGATTTTCAAAGG + Intronic
1110529834 13:76583113-76583135 CATGATCTAAAGAAATTCGAAGG + Intergenic
1114367017 14:22039921-22039943 CAAAATTGGTAGATATTAGAAGG - Intergenic
1116025202 14:39506501-39506523 CATCATTTGTAGAAACTTTATGG - Intergenic
1117125451 14:52618562-52618584 CTTCATTTGTAGAATTTCTAGGG + Intronic
1118115218 14:62768194-62768216 TATAATTTGTATAAATTTAAGGG - Intronic
1119067728 14:71547134-71547156 CCTGATTTTTAGAAATTCTATGG + Intronic
1119439958 14:74621605-74621627 CATAAATTGAAGAAATGGGATGG - Intergenic
1125368544 15:38945477-38945499 CATGATGTGTAGAAATGCAAGGG + Intergenic
1134347699 16:13406579-13406601 CATAAGTTGTAGAAGTCTGAGGG - Intergenic
1146664628 17:34690270-34690292 CTTTATTTGTAGAAATTCATAGG + Intergenic
1149879908 17:60279322-60279344 AATAATTTTTAGAAATTAGCCGG + Intronic
1151591160 17:75045882-75045904 CATAAATTGTAGAGATTTCATGG - Intronic
1155895551 18:31321440-31321462 AATATTTTGTAGAAAATGGAAGG + Intronic
1156412519 18:36845872-36845894 CATATTTTGTAGGAAGTAGAGGG - Intronic
1159993995 18:74943910-74943932 CATAATTTGTAGAAATTCGAAGG - Intronic
1165416748 19:35698960-35698982 AATAATTTGTAGTAATTAGCTGG + Intergenic
927262372 2:21104768-21104790 CATAATTTGAAATAATTTGAGGG - Intergenic
928505207 2:31944540-31944562 GACAATTTGTTGAAATACGAGGG - Intronic
928560324 2:32477031-32477053 CATAATTTGTAAAAGCTTGAAGG - Intronic
928616900 2:33050001-33050023 CAAAATTTGTAAAAATTGGCTGG - Intronic
928694090 2:33831297-33831319 CATAATTTTTAAAAATCCAATGG - Intergenic
930530824 2:52586306-52586328 CATAATTTATAATAATTAGAAGG + Intergenic
931033056 2:58205327-58205349 CATAATCTGTAGAAAGTCTAGGG + Intronic
936681852 2:114783332-114783354 CAAAAATAGTTGAAATTCGAAGG + Intronic
940111485 2:150159845-150159867 AATAAATTGTAGAAATTTCAAGG + Intergenic
940247785 2:151637912-151637934 CATAATTTAGAGAATTTAGATGG - Intronic
942106050 2:172634820-172634842 CATAATTTATAAAAACTCTAAGG + Intergenic
943993187 2:194723909-194723931 TATAATTTGTATAAATCTGATGG - Intergenic
945874223 2:215260973-215260995 TAAAATTCGTAGAAATTCAATGG - Intergenic
945874227 2:215261161-215261183 TATAATTTACAGAAATTCAATGG + Intergenic
946056492 2:216907033-216907055 AAAAATTTGTATAAATTCAAGGG - Intergenic
948686244 2:239671437-239671459 CAGAATGTTTAGAAATTCAAAGG + Intergenic
1170526023 20:17238748-17238770 CAGAATTTATAAAAATTCTACGG - Intronic
1171047452 20:21823964-21823986 GAAAATTTGGAGAAATTTGAAGG - Intergenic
1173220333 20:41127112-41127134 CATTATTTGAAGAATTTCTAAGG - Intergenic
1177046416 21:16175699-16175721 CAGAATTTTCAGAAATTTGAAGG - Intergenic
1178140169 21:29673771-29673793 CTTAATTTCTAAAAATTCTATGG - Intronic
1178708508 21:34893596-34893618 CATTATATGTAGATATTCAAAGG - Intronic
1182190070 22:28450639-28450661 TATAATTTGTAAAAAGTCTATGG - Intronic
951349197 3:21584672-21584694 CATTATTTGTAGAAAATAAAGGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956624961 3:71258049-71258071 CATACTATGTAGATATTCGTAGG - Intronic
959385560 3:105701427-105701449 CACAACTTGTAAAAATTGGATGG + Intronic
961402531 3:126657236-126657258 CACAATGTGAAGAAATTCCATGG - Intergenic
963312569 3:143724649-143724671 CATAATTTGAAATAATTTGAAGG - Intronic
965439198 3:168691940-168691962 CATAATCTGCAGAAATACCAGGG + Intergenic
966095249 3:176192742-176192764 AATAATTTGGAGAAATAAGAGGG - Intergenic
966302872 3:178498301-178498323 AATAATTAGTAGATATTCGAAGG + Intronic
971749839 4:30632854-30632876 TGTTATTTGTATAAATTCGAGGG - Intergenic
971803156 4:31318637-31318659 CTTAATTTGAAGAAAATCCAAGG - Intergenic
972364722 4:38363639-38363661 CATATTTTGTAGAACTCCCATGG + Intergenic
972728549 4:41769331-41769353 CATAATTTTTTCAAAATCGAAGG + Intergenic
973005446 4:44999870-44999892 CATAAATTGTAGAAAGTTAATGG - Intergenic
973087064 4:46077857-46077879 GATAATTTTTAGAGATTCTAAGG + Intronic
974544539 4:63283666-63283688 CATAAAATGTAGACATTAGAGGG - Intergenic
974661486 4:64895699-64895721 GATAATTTGTAGCAATTTGGGGG + Intergenic
975891866 4:79039134-79039156 TATAATTTGGAGAAATTTGGAGG + Intergenic
977392652 4:96431414-96431436 CATAATTAGTAGATTTTCTAAGG - Intergenic
980160168 4:129151491-129151513 CATTATCTGTAGAAATTCTGTGG + Intergenic
980720781 4:136692038-136692060 TATAATTTCTATATATTCGAAGG + Intergenic
981147311 4:141340133-141340155 CATAATTTCTAGGAATTCATAGG - Intergenic
982793868 4:159622733-159622755 CATAATTTCTGGAAAATGGAAGG + Intergenic
984187730 4:176566626-176566648 CATAATTTGTAAATATCAGAAGG - Intergenic
984303626 4:177956823-177956845 CATAATGTATAGAAATTGAATGG + Intronic
984620661 4:181948834-181948856 CATACTTTGTGGAAATTAAATGG - Intergenic
985100666 4:186455175-186455197 CATAATGTGTACAAAATGGATGG - Intronic
985253645 4:188047531-188047553 CATATTTTGTAGATATTTTAAGG - Intergenic
985308332 4:188569164-188569186 CATATTTTGAAGAATTTCTACGG + Intergenic
987652482 5:20760821-20760843 CATAATTTCCTGAAATTCAATGG - Intergenic
988041753 5:25898169-25898191 CATAAGTTAAAGAAATTCCATGG - Intergenic
988743078 5:34100662-34100684 CATAATTTCCTGAAATTCAATGG + Intronic
991625968 5:68601415-68601437 CATAAATTGTAAATATTCCATGG + Intergenic
994429319 5:99636516-99636538 CAGAATTTGTACAAATTGAAAGG - Intergenic
1005154385 6:22787326-22787348 AATAACTTGGAGAATTTCGATGG - Intergenic
1009530419 6:64805815-64805837 CATAATTTTTAAAAATCCCAAGG + Intronic
1011900191 6:92285085-92285107 CATAATGTGATGAAATTTGAAGG + Intergenic
1015406925 6:132848119-132848141 AATCATTTGTAGAAAATAGAAGG + Intergenic
1015463791 6:133524444-133524466 AAGAATATGTAGAAATTCCACGG + Intronic
1016064902 6:139671491-139671513 CAGATATTGCAGAAATTCGAAGG + Intergenic
1016098841 6:140072216-140072238 AATAATTAGTAGAAATATGATGG - Intergenic
1017251066 6:152280053-152280075 CATAATTTTTAGCACTTCCATGG + Intronic
1017287031 6:152687649-152687671 CATAATATGTAAAACTTTGATGG - Intergenic
1017690339 6:156957617-156957639 CATCATTTGTATACATTCAAGGG - Intronic
1017949556 6:159124942-159124964 CATAATTTTAAGGAATTAGATGG + Intergenic
1021473995 7:21039820-21039842 GATAATTTGGAGAAATCCTAAGG + Intergenic
1024152530 7:46587387-46587409 CATAATAGGTAGAAATTAAATGG + Intergenic
1024535137 7:50424180-50424202 CAGACTTTGTGGAAATTCTATGG - Intergenic
1024745607 7:52402197-52402219 ATTAATTTGAAGATATTCGAAGG - Intergenic
1027686402 7:81284005-81284027 TATAATTTGTGGACATTCAAGGG - Intergenic
1031333809 7:120500497-120500519 CACAATTTTTAGAAATTCCCAGG + Intronic
1032408939 7:131678834-131678856 CAAAATTTTTAGAAATTTGGGGG + Intergenic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1036514415 8:9430460-9430482 CATAAATTGTAAAAATTTCATGG + Intergenic
1036664142 8:10727985-10728007 GAAAATTTATAGAAATTCCATGG + Intronic
1040983698 8:53270709-53270731 CAGATTTTGTAGAAATTTTAAGG + Intergenic
1044100492 8:88130828-88130850 CATAATTTTTACAGATTCTAAGG + Intronic
1044242950 8:89908060-89908082 CATACTTTGGAGAAATACCAGGG + Intronic
1044653981 8:94528624-94528646 CATTATTTTTAAAAATTCAAGGG - Intronic
1046005926 8:108483584-108483606 CATAATTTGTGGAAAATACATGG - Intronic
1052660762 9:31427298-31427320 CAGAATTTGTAAAAATTGCAAGG - Intergenic
1054885542 9:70194047-70194069 CATCATATGTAGCAATTCCAAGG + Intronic
1056147189 9:83744113-83744135 CATAATTTGTAAAAGTTCCCAGG - Intronic
1057565354 9:96161741-96161763 GATAATTTGTAGAAAGTGCATGG + Intergenic
1058127621 9:101213417-101213439 CATATTATGTGGAAATTCTAAGG + Intronic
1186147269 X:6637368-6637390 CATTATTTGTAGAGATGCGGGGG - Intergenic
1186656018 X:11612980-11613002 CATAATTTATTGAAATTGAATGG + Intronic
1188517887 X:31007016-31007038 CATATTGTGTATAAAGTCGAAGG + Intergenic
1188990705 X:36816450-36816472 CATAATTTGTAATAATTCGTGGG + Intergenic
1191122566 X:56921407-56921429 CAGAATTTGGAAAAATTTGAAGG + Intergenic
1192818748 X:74620663-74620685 AATAACTTGTACAAATTCCATGG + Intergenic
1194495332 X:94609757-94609779 CAGATTTTGCAGAAATTCAAAGG - Intergenic
1195611070 X:106867213-106867235 AATAATTTGTAGTATTTCGCAGG - Intronic
1197325503 X:125088832-125088854 CAAAATTTGTATAAATTTAAGGG - Intergenic
1197902269 X:131386942-131386964 CATTATTTGTAGTAATTAAAAGG - Intronic
1199379628 X:147155046-147155068 AATATGTTGTAGAAATTCTATGG + Intergenic
1199924417 X:152447636-152447658 CGTAATTTGTAGAAACTCTAAGG + Intronic
1200923516 Y:8634045-8634067 CAGAATTTGAGGAAATTCAAGGG - Intergenic
1201867038 Y:18667074-18667096 GATTATTTGTAGAGATTAGAGGG - Intergenic