ID: 1159994686

View in Genome Browser
Species Human (GRCh38)
Location 18:74952796-74952818
Sequence CATTTCTCCCAGAAGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159994681_1159994686 17 Left 1159994681 18:74952756-74952778 CCTTGAAACCATGGCCATAATTA 0: 1
1: 0
2: 5
3: 59
4: 379
Right 1159994686 18:74952796-74952818 CATTTCTCCCAGAAGTTGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1159994682_1159994686 9 Left 1159994682 18:74952764-74952786 CCATGGCCATAATTAAAATAATG 0: 1
1: 1
2: 3
3: 24
4: 323
Right 1159994686 18:74952796-74952818 CATTTCTCCCAGAAGTTGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1159994680_1159994686 18 Left 1159994680 18:74952755-74952777 CCCTTGAAACCATGGCCATAATT 0: 1
1: 0
2: 1
3: 27
4: 273
Right 1159994686 18:74952796-74952818 CATTTCTCCCAGAAGTTGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1159994683_1159994686 3 Left 1159994683 18:74952770-74952792 CCATAATTAAAATAATGAACACA 0: 1
1: 0
2: 15
3: 120
4: 864
Right 1159994686 18:74952796-74952818 CATTTCTCCCAGAAGTTGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159994686 Original CRISPR CATTTCTCCCAGAAGTTGTG AGG Intronic
902565711 1:17310020-17310042 CATTTCTCCCAGAAAGGATGGGG + Intronic
904946355 1:34201468-34201490 CCTTTCTACAAGATGTTGTGGGG - Intronic
906263604 1:44411739-44411761 CATTTCACCCAGAACGTGTAGGG + Intronic
907450133 1:54541110-54541132 CTTTTCTCCCCAGAGTTGTGGGG + Intergenic
912677372 1:111696485-111696507 CACTTGTCCCATAAGTGGTGGGG + Intronic
914245606 1:145883712-145883734 CATTTGTCAGAGAAGTAGTGTGG - Intronic
916275865 1:162992531-162992553 TCTTTCACCCAGGAGTTGTGGGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
919776881 1:201200019-201200041 CATTTCTCCTGAAAGTTGTGGGG + Intronic
923851019 1:237795296-237795318 AATTTGTCCCAGTAGTTGTTGGG - Exonic
923860951 1:237891428-237891450 CATTTCCCCCAGATCCTGTGGGG - Intergenic
1063176721 10:3557377-3557399 CATCTCACCCAGAAGCAGTGAGG - Intergenic
1063809696 10:9690877-9690899 TATTTCTGTCAAAAGTTGTGGGG + Intergenic
1069597380 10:69681181-69681203 GATTTCTCTCCCAAGTTGTGAGG - Intergenic
1070874102 10:79785114-79785136 CACTTCACCGAGAGGTTGTGAGG - Intergenic
1071641036 10:87307253-87307275 CACTTCACCGAGAGGTTGTGAGG - Intergenic
1071654201 10:87430683-87430705 CACTTCACCGAGAGGTTGTGAGG + Intergenic
1071907172 10:90187136-90187158 CATTTCTCCCAAAGTATGTGGGG + Intergenic
1074889322 10:117721998-117722020 CATTTCTTTAAGAAATTGTGAGG - Intergenic
1075021153 10:118953346-118953368 CATTTCTCAGAGGAGATGTGAGG + Intergenic
1076726044 10:132413796-132413818 CTTTTCTCCAACAAGCTGTGGGG + Intronic
1080288309 11:30641481-30641503 CCTTTCTCCCAGCACCTGTGAGG + Intergenic
1083961873 11:66019075-66019097 CACTTCTTCCAGAAGTGGGGTGG - Intronic
1084934474 11:72579526-72579548 CATTTCTCCCGGAAGGTGATGGG - Exonic
1085261561 11:75208416-75208438 CCTATCTCCCAGAAGCTGTGAGG + Intergenic
1085753893 11:79188088-79188110 CAAATGTCCCAGCAGTTGTGTGG - Intronic
1086018537 11:82197142-82197164 CATTTAACTCAGTAGTTGTGTGG - Intergenic
1086495329 11:87398840-87398862 CCTTTCTCCTAGGAGTTGTTTGG + Intergenic
1086859908 11:91913648-91913670 GAGCTCTCCCACAAGTTGTGTGG + Intergenic
1087349656 11:97015467-97015489 CTATTCTCCCAGCAGTTGAGAGG + Intergenic
1088591658 11:111408611-111408633 CATTTCTACCTGAAGGTGAGAGG + Intronic
1089440035 11:118507575-118507597 CAGTCCTCCCAGAAGGAGTGTGG + Exonic
1090454261 11:126834253-126834275 CATTTGGCCCAGAATTTGGGTGG + Intronic
1090939809 11:131377217-131377239 CTTTTCTACAAGAGGTTGTGTGG - Intronic
1093389865 12:18605169-18605191 CATTTCTCCATGAAGTTATTTGG - Intronic
1093616769 12:21234537-21234559 AATTTCTCCCAGAATTAGTTCGG + Intronic
1093641593 12:21533524-21533546 CATTTCACACAGTTGTTGTGAGG - Intronic
1094422510 12:30285997-30286019 AATTTCTCCAAGAAGTTTTGGGG + Intergenic
1096396111 12:51268124-51268146 CATTGTTCCCTGAAGGTGTGCGG - Intronic
1097248148 12:57617960-57617982 CGGCTCTCCCAGAAGTTGGGAGG - Intronic
1099294354 12:80811579-80811601 CATTTCTTCCAGAACTTTTGGGG + Exonic
1101016337 12:100504745-100504767 CATTTCACCCACAACTTGTTAGG - Intronic
1102260399 12:111439890-111439912 CCTTTCCCCCAGCAGTTGTCTGG + Intronic
1104441596 12:128797732-128797754 GAGTTCTCCCTGAATTTGTGTGG - Intronic
1105326716 13:19377006-19377028 CATTTCTGCCAGGTCTTGTGCGG + Intergenic
1105935421 13:25094168-25094190 CAGATTTCCCAGAAGTTTTGAGG - Intergenic
1106091682 13:26601231-26601253 CATTTATCTCAGCAGTTTTGAGG + Intronic
1107727920 13:43318619-43318641 CCTTTGTCCCAGAAGTTGATAGG - Intronic
1107882751 13:44847148-44847170 CATTGTTGCCAGGAGTTGTGGGG - Intergenic
1108424379 13:50283981-50284003 CATTTCTCCCAGGAATTGGAAGG - Intronic
1109508117 13:63333752-63333774 CATTTCTCACAGAGGTTATTTGG + Intergenic
1109664990 13:65522529-65522551 AATTGTTCCCAGAAGTAGTGTGG + Intergenic
1112063335 13:95764541-95764563 GATTCCTGCCAGATGTTGTGAGG + Intronic
1113549717 13:111183404-111183426 TATTTCTCTCAGAAGCTGTCTGG + Intronic
1113818715 13:113194977-113194999 CATTCTTCCCAGAAGTTTTGAGG - Intronic
1114538589 14:23438463-23438485 AATTACTCCCAGTAATTGTGAGG + Intergenic
1115430522 14:33312742-33312764 CATTTTTCTCAGATGTTGTGAGG + Intronic
1115509612 14:34126724-34126746 CATTTCTATCAGGGGTTGTGAGG - Intronic
1115782435 14:36784644-36784666 CTTGTCTCCTAGAAGTTGTCTGG - Intronic
1117256230 14:53980867-53980889 CATTTGTCCTGGAAGTTGGGTGG + Intergenic
1117834228 14:59785542-59785564 CATTTCTCCCAGAATTAATCTGG + Intronic
1118386430 14:65259114-65259136 CATCTCTCCAAGCAGTTTTGAGG - Intergenic
1118504247 14:66393219-66393241 CATTTCTCAGAGAAGGGGTGTGG + Intergenic
1119989513 14:79179963-79179985 CATTCCTCCCTAATGTTGTGAGG + Intronic
1120123183 14:80707475-80707497 CAATTCTCCAAGGAGTTTTGGGG + Intronic
1121855770 14:97268900-97268922 CATTTCACCCACAGGTTGAGCGG - Intergenic
1122599002 14:102912115-102912137 CATTTCTCCAGGAAGTTGTTTGG + Intergenic
1124373711 15:29117448-29117470 CTTTCCTCCCTGAAGCTGTGCGG + Exonic
1126388585 15:48120634-48120656 CCTTTCCCCTAGAAGTTGTTTGG - Intergenic
1126933253 15:53678040-53678062 CATTTCTACCAGAGATTATGGGG + Intronic
1127257308 15:57303208-57303230 GATTGCTGCCAGAAGTTGGGTGG - Intergenic
1129194933 15:73958236-73958258 AATTCCTCCTAGAAGTAGTGTGG + Intergenic
1129693259 15:77725604-77725626 CCTTTCTCAGGGAAGTTGTGAGG - Intronic
1130152153 15:81319387-81319409 CATTTCTCCCAGAGATTTTGTGG - Exonic
1131594535 15:93783556-93783578 CAGTGCTCCCAGAATTTATGTGG - Intergenic
1133592162 16:7256338-7256360 CATTCCTACCAGAAGTTCTGAGG + Intronic
1133736472 16:8619758-8619780 CATTTCTGCCACAAATTTTGAGG - Intergenic
1135842869 16:25892696-25892718 CATTCCTCAAAGATGTTGTGAGG + Intronic
1137721841 16:50632035-50632057 CACTCCTCCCAGAAGCTGCGGGG + Intronic
1141280006 16:82622897-82622919 CATTTGTCACAGAAGTTGCATGG + Intergenic
1142703702 17:1680679-1680701 CATTTCTCCTAGAAGAGCTGAGG + Intronic
1142905828 17:3041208-3041230 CCTTCCTCCCAGAAAATGTGAGG + Intergenic
1144612746 17:16737934-16737956 TATTCCTCACAGAAGTTGAGAGG + Intronic
1144676226 17:17163844-17163866 TATTTCTCCTAGAAGCTGTTTGG + Intronic
1144900038 17:18577659-18577681 TATTCCTCACAGAAGTTGAGAGG - Intergenic
1145132406 17:20368005-20368027 TATTCCTCACAGAAGTTGAGAGG + Intergenic
1147185330 17:38710332-38710354 CGTGTGTCCCAGAAGCTGTGAGG + Intronic
1147885726 17:43683188-43683210 CATTTCTCACAGACGTGGTCTGG + Intergenic
1148681961 17:49479270-49479292 CATATCTCCCAGGAATGGTGTGG + Intergenic
1151431339 17:74065532-74065554 CACTTGTACCATAAGTTGTGGGG + Intergenic
1152267434 17:79304029-79304051 CATTTCTCACAGAAGCTCTTTGG + Intronic
1153703351 18:7718816-7718838 CATTTCTCTGATAAGTAGTGAGG - Intronic
1155174795 18:23292568-23292590 CAGTTCTCCAAGAAGTGCTGAGG - Intronic
1155494528 18:26429556-26429578 CATCTCTCCCCCAAGTTCTGAGG - Intergenic
1155550591 18:26961030-26961052 CAGTTCTCCCAGCACTTCTGTGG + Intronic
1156242894 18:35271002-35271024 CATTCCTCCCAGTAGGTTTGTGG + Intronic
1156681927 18:39600716-39600738 CATTTCCTCAAGAACTTGTGTGG - Intergenic
1158870234 18:61679750-61679772 GATTTCTCCCAGAGGTTGAAGGG + Intergenic
1159953617 18:74504022-74504044 CATTTGTCCCAGCAGCAGTGTGG - Intronic
1159994686 18:74952796-74952818 CATTTCTCCCAGAAGTTGTGAGG + Intronic
1160667492 19:338941-338963 ATTTTCTCCGAAAAGTTGTGTGG - Intronic
1161218980 19:3109282-3109304 CATGTCACCCAGAATGTGTGGGG + Intronic
1163919575 19:20276155-20276177 CATCTCTCCCAGATTGTGTGGGG - Intergenic
1166088635 19:40493512-40493534 CATCTCTACAAAAAGTTGTGGGG + Intronic
1166787804 19:45379777-45379799 CATCTCTCCCAGCAGTCTTGGGG - Exonic
1167973399 19:53203977-53203999 CATTTCACCAAGAAGTCATGGGG - Intergenic
1168559587 19:57371812-57371834 TATTTCTCCCAGGAGGAGTGGGG + Exonic
1168562718 19:57397078-57397100 TATTTCTCCCAGGAGGAGTGGGG + Exonic
1168565373 19:57417942-57417964 CATTTCTCCCAGGAGGAGTGGGG + Exonic
926484079 2:13433404-13433426 CCTTTCTCCCAGAACATTTGGGG + Intergenic
927151438 2:20198643-20198665 CCTTTCTCCCAGATGCTGTGGGG + Intergenic
927532110 2:23815711-23815733 CTTTTCTTCCACTAGTTGTGAGG - Intronic
931443230 2:62305941-62305963 CATTTTTTCCAGATGTGGTGAGG + Intergenic
935574956 2:104699729-104699751 CATTTCTCCCAGAACTGCAGTGG - Intergenic
938680451 2:133684486-133684508 CATTTCTTACACAAGTTGTTGGG + Intergenic
938745382 2:134273115-134273137 CATTTCCCCCAGAAGGTGGGGGG + Intronic
940856955 2:158736625-158736647 GATATCACCCAGATGTTGTGGGG - Intergenic
940901221 2:159128345-159128367 CCTGTATCCCAGGAGTTGTGGGG + Intronic
941237435 2:162992728-162992750 CATTTCTCCCACAAGCCTTGTGG - Intergenic
941988751 2:171534205-171534227 CATTTCTCCCAGAAAATGAGGGG - Intronic
942321117 2:174736723-174736745 TATTTGTCCCAGAAGTTTTTAGG - Intergenic
943711456 2:191100276-191100298 CATTTCTCTCAGTAGTTGGACGG - Intronic
944547188 2:200810790-200810812 CATTTTTCCATGAAGTTGCGGGG + Intronic
1172187364 20:33039504-33039526 TCTTTCTCCTAGAAGTGGTGAGG + Exonic
1173108799 20:40165284-40165306 CATTTCTTCTAGAAGTTTTAAGG + Intergenic
1173763963 20:45589138-45589160 CATTTCAGCCAGAAGTGGAGAGG - Intergenic
1174983748 20:55425876-55425898 CACCTCTCCCAGAAGTTGTAGGG - Intergenic
1177756499 21:25354996-25355018 CACTTCCCCCAGAAGTTTAGAGG + Intergenic
1179835740 21:44031560-44031582 CTTTCCTCCCAGGAGTTATGGGG + Intronic
951477256 3:23120236-23120258 AATTTATCCCAGAGATTGTGAGG + Intergenic
951824699 3:26855257-26855279 AATTTGTTCCAGCAGTTGTGAGG - Intergenic
961068513 3:123898073-123898095 CATTTCTACCTCAAATTGTGTGG + Intronic
961108683 3:124264631-124264653 TGTTTCTGCCAGAAGTTGTCGGG - Exonic
963270076 3:143277808-143277830 CATTTCTCCAACAAATTGTCAGG - Intronic
963359031 3:144246599-144246621 GATTTCTATCAGATGTTGTGGGG + Intergenic
964776184 3:160280902-160280924 CATATCTACCAGAAATTGTATGG - Intronic
967265430 3:187687233-187687255 CTCCTCTCCCAGAAGTTGGGTGG - Intergenic
968310875 3:197682216-197682238 CTTTCCTCCCAGTAGTTGTGTGG - Intronic
969221341 4:5760872-5760894 CATGTCTCCCAGAATTAGTCTGG + Intronic
970700807 4:18735815-18735837 CATTTGTTCTAGAAGTTCTGTGG + Intergenic
971043210 4:22777978-22778000 CATTTCTCCCAGTAGGTTCGTGG + Intergenic
971599653 4:28576074-28576096 GATTTCTCACAGAGGTTCTGGGG - Intergenic
972684150 4:41335579-41335601 CATTTCTCTCAGAAGGTATCAGG - Intergenic
974098664 4:57393126-57393148 CATTTCTACTAGTAGTAGTGTGG - Intergenic
978811191 4:112851436-112851458 CATTTCTCCCATACCTTCTGTGG + Intronic
980489443 4:133506089-133506111 CTTTTCTCCTGGAAGTTCTGAGG + Intergenic
982081518 4:151794737-151794759 CGTTTCTTCCAGAAGTCTTGTGG + Intergenic
982365130 4:154569565-154569587 CATTTCTATCAAAAGTTCTGTGG - Exonic
982744370 4:159091269-159091291 CATTCCTCCCAGAAATTCTTAGG + Intergenic
983144405 4:164195488-164195510 CATTTGTCTGAGAAATTGTGGGG - Intronic
983314219 4:166107310-166107332 CATGTTTCCCAAAAGTTTTGGGG - Intergenic
984285170 4:177719652-177719674 TGTTTCTTCCAGAAGATGTGAGG - Intergenic
984764382 4:183388392-183388414 CAGGTCACCCAGCAGTTGTGTGG - Intergenic
987065645 5:14287004-14287026 TGTTTCTGCCAGAAGTTGTCTGG - Exonic
987399795 5:17463595-17463617 CTTTCCTCCCAGTAGTTCTGAGG - Intergenic
988041700 5:25897142-25897164 CATTTCTCCAAGATGTGTTGTGG + Intergenic
988683274 5:33503432-33503454 CATTCCTCCCTGAGGTTGTCTGG - Intergenic
988911985 5:35852389-35852411 CATTTCTGCCAGAAAGTGAGTGG - Intergenic
989502871 5:42189448-42189470 CAATTCTCCCAGTTGTTTTGGGG - Intergenic
990547489 5:56837419-56837441 CATTTTTCCCAAGAGTGGTGTGG + Intronic
991216079 5:64158581-64158603 GATTTCTCCCATAAGTGGTTTGG - Intergenic
993126952 5:83847046-83847068 CAATTCTTCCAGAAGTGATGGGG - Intergenic
993170601 5:84414094-84414116 GAGTTCTCCCACAAGTTTTGTGG - Intergenic
993839771 5:92863758-92863780 AAATTCTACCAGAAGTTGTGCGG + Intergenic
996484081 5:124010922-124010944 GACTGGTCCCAGAAGTTGTGTGG - Intergenic
997015393 5:129927924-129927946 CATTTTTCCTAGGAATTGTGGGG - Intronic
997722024 5:136086479-136086501 ATTTTCTCCTAGAAGTTGTATGG - Intergenic
997761415 5:136451778-136451800 AAATTCTTCCATAAGTTGTGGGG - Intergenic
999598900 5:153238384-153238406 CATTTCTCTCAGATCTTGAGAGG + Intergenic
1000859681 5:166441196-166441218 CATCTTTTCCAGAAATTGTGAGG - Intergenic
1001095323 5:168771371-168771393 CTTCTCTCCCAGATGCTGTGTGG + Intronic
1007060432 6:38935236-38935258 CATTTCTTACAGAAGCAGTGTGG + Intronic
1007311684 6:40951574-40951596 CATTTCTGACAGTGGTTGTGAGG + Intergenic
1007834796 6:44666202-44666224 CAGCTTTCCCAGAGGTTGTGGGG + Intergenic
1008424601 6:51342417-51342439 CATTTTTCCCGTAAGTTCTGTGG - Intergenic
1008732059 6:54494438-54494460 CATTTCTCCCACCACTTTTGGGG - Intergenic
1010075463 6:71792189-71792211 CATTTCTCCCAGTGGGTTTGTGG - Intergenic
1010923843 6:81719301-81719323 CATTTCTCTAAGAAGCTTTGAGG + Intronic
1011399939 6:86949578-86949600 CATTTCTATCAAAAGTTTTGAGG + Intronic
1012226969 6:96715929-96715951 CATTACACCCAGGTGTTGTGAGG + Intergenic
1012687504 6:102270500-102270522 CATTATTCCCACATGTTGTGGGG - Intergenic
1013614486 6:111829051-111829073 CATTGGTCCCAGGAGATGTGTGG - Intronic
1014182297 6:118398383-118398405 CAATTTTCCTACAAGTTGTGTGG - Intergenic
1014483296 6:121965700-121965722 CATTTCTGCCATATGTTGTTTGG - Intergenic
1014973156 6:127844014-127844036 CATTTCTCACATAATTTATGAGG - Intronic
1016517431 6:144910471-144910493 CATTTCTCTCTGAAGTTATTTGG - Intergenic
1018143842 6:160864781-160864803 CTTTCCTCCCAGAACATGTGGGG + Intergenic
1022499772 7:30875327-30875349 CAATTCTCCCACAAGTCCTGTGG - Intronic
1024144044 7:46493034-46493056 CAAGTCTCCCAGAAGGTGAGAGG + Intergenic
1026476568 7:70741283-70741305 CATTTCTCCCATAAGTCTTATGG - Intronic
1027651745 7:80876909-80876931 CATTGCTCCCAGCAGTTCTCGGG + Intronic
1028107355 7:86894928-86894950 CACTTCTATCACAAGTTGTGCGG + Intronic
1028113434 7:86970436-86970458 CCTTTCTCCCAGAGGATTTGCGG - Intronic
1031281421 7:119805810-119805832 CAATTTTCCCAGAAGTTTTCTGG + Intergenic
1031800629 7:126239944-126239966 CTTTTCTCACACAAGTTGTTAGG - Intergenic
1032960874 7:137032756-137032778 GATTTCTCACAGAAGTAGCGGGG + Intergenic
1033086885 7:138350996-138351018 CATCTCTCCAAGGAGTTCTGGGG - Intergenic
1033344841 7:140518803-140518825 CTTTCCACCCAGAAGTGGTGCGG + Intronic
1033620529 7:143058353-143058375 CAATTCACCCAGAAGTTCTTGGG + Intergenic
1033712529 7:143963255-143963277 CATTTCTGCCAGCGGTCGTGTGG + Intergenic
1037336094 8:17793533-17793555 TATTTCTCCCAGATGTGGTCTGG - Intronic
1038407227 8:27331191-27331213 CAATTCTCCCAATAATTGTGGGG + Intronic
1038671461 8:29586458-29586480 CATTCCTTCCAGAAGGTGGGAGG + Intergenic
1039299609 8:36195197-36195219 CTTTTCTTTCAGAAGTTGGGTGG + Intergenic
1043084902 8:75817374-75817396 TATTTTTCCCAGTATTTGTGAGG + Intergenic
1044058945 8:87609067-87609089 CATTTCACCCTGAATTTGTCAGG + Intronic
1044534552 8:93344423-93344445 GCTTTCTCCCGGAAGTTCTGAGG + Intergenic
1046213621 8:111113775-111113797 TATTTGTCCCAGAACATGTGGGG - Intergenic
1046257523 8:111721038-111721060 CATTTCTCCCTCAACATGTGGGG + Intergenic
1047658863 8:127010524-127010546 CATTTTTCCAAGAATTAGTGAGG + Intergenic
1048089234 8:131220716-131220738 CATGTTTTCCAGAAATTGTGTGG + Intergenic
1048259316 8:132932146-132932168 CATTTTACCCAGAAACTGTGTGG - Intronic
1051100700 9:13517892-13517914 GGTCTCTCCCAGGAGTTGTGGGG - Intergenic
1052708321 9:32020751-32020773 CATTTCTTCCAGAAGCTCTAAGG + Intergenic
1055287038 9:74739774-74739796 CCTTTCTTCCTGAGGTTGTGCGG - Exonic
1058719342 9:107749672-107749694 CCTTTCTCCCAGACCCTGTGGGG - Intergenic
1059801734 9:117756518-117756540 CAGTTCTCGAAGAATTTGTGTGG + Intergenic
1060414017 9:123418224-123418246 CACATCTCCCAGCAGTGGTGTGG - Intronic
1185636027 X:1552706-1552728 CATTTCTCCCACAAACTGTAGGG - Intergenic
1186522869 X:10221270-10221292 CATTTTTCCCACAAGTCCTGTGG - Intronic
1186591072 X:10930621-10930643 CCTATATCCCAGGAGTTGTGAGG - Intergenic
1187864340 X:23710331-23710353 CATTTCTCCAAGTAGTCCTGGGG - Intronic
1188137323 X:26505258-26505280 CACTCCTCCCACAAGTTGGGAGG + Intergenic
1189156282 X:38760254-38760276 CATTGCTCACACAAGTTGTTTGG - Intergenic
1192550216 X:72047665-72047687 GATTTCTCCCAAACATTGTGAGG + Intergenic
1195675386 X:107503713-107503735 CCTTTCTCCCAGTGGTTGTCAGG - Intergenic
1200779054 Y:7197853-7197875 CATTTGACCCAGAGGCTGTGGGG + Intergenic
1202046286 Y:20739701-20739723 CATTTGTCCCTGAAGGTGAGTGG - Intergenic
1202352803 Y:24011717-24011739 CCTTTCTCCCAGAACTTTTCTGG + Intergenic
1202517976 Y:25658398-25658420 CCTTTCTCCCAGAACTTTTCTGG - Intergenic