ID: 1159995225

View in Genome Browser
Species Human (GRCh38)
Location 18:74957939-74957961
Sequence GCTTCCTTGTTACCTGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159995220_1159995225 -9 Left 1159995220 18:74957925-74957947 CCTTTCCCACCTCTGCTTCCTTG 0: 1
1: 0
2: 7
3: 91
4: 970
Right 1159995225 18:74957939-74957961 GCTTCCTTGTTACCTGGCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159995225 Original CRISPR GCTTCCTTGTTACCTGGCAG AGG Intronic
902368595 1:15992267-15992289 GCTTCCTTGTTTCCTCATAGAGG - Intergenic
902453453 1:16514268-16514290 GTTTCATACTTACCTGGCAGGGG - Intergenic
904914575 1:33960619-33960641 GCTTCCATGGTGCCTGGCACAGG - Intronic
905267700 1:36766079-36766101 CCTTCCTGGGCACCTGGCAGGGG + Intergenic
905278307 1:36833336-36833358 TCTTCCTTCTGACCTGTCAGTGG + Intronic
907554540 1:55333208-55333230 CCTTCCTTGTTCTCTGGAAGGGG - Intergenic
908734059 1:67257346-67257368 GCTGCCTTCTCACATGGCAGAGG + Intronic
909084976 1:71159662-71159684 GTCTCCTTCTTAGCTGGCAGAGG + Intergenic
909399135 1:75206895-75206917 GTTTCAGTGTTTCCTGGCAGAGG - Intronic
913360610 1:117976358-117976380 GGTTCCTTGTTACCATGCTGAGG + Intronic
914449721 1:147780340-147780362 GCTTTCTTTCTACATGGCAGTGG + Intergenic
917132455 1:171756676-171756698 GCTTCCTTATTACAGGGCATTGG - Intergenic
919392170 1:197000625-197000647 GCTTCCCTATTTCCTGGCACTGG + Intronic
920301722 1:204992964-204992986 GCTTCCGTGTGACATGGCAGTGG + Intronic
922015932 1:221647037-221647059 GCTGCCTCGTAACATGGCAGAGG + Intergenic
922904638 1:229164742-229164764 GCATCCTTGTTAGCCAGCAGGGG + Intergenic
922959514 1:229634554-229634576 GCTTAGATGTTACCAGGCAGAGG - Intronic
1063257825 10:4348340-4348362 GCTTCCTTGTTACATGTTAGAGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1070178710 10:73994882-73994904 GTTTCCTTGCTAGCTGTCAGGGG + Intergenic
1073385507 10:103124409-103124431 GCTTGCTTGGTAGATGGCAGTGG - Intronic
1074237664 10:111602183-111602205 ATTTCCTTGTTGCCTGTCAGTGG + Intergenic
1077596293 11:3534574-3534596 GCTTCTTTGGTTGCTGGCAGTGG - Intergenic
1078019723 11:7645895-7645917 GTTTCCTTGTTTCTTGGAAGTGG - Intronic
1078687691 11:13548587-13548609 CTTTCCTTCTTGCCTGGCAGGGG - Intergenic
1083580209 11:63819815-63819837 GTTTCCTTGTTTCCTGGAATTGG + Intronic
1084252201 11:67908551-67908573 GCTTCTTTGGTTGCTGGCAGTGG - Intergenic
1084447594 11:69212780-69212802 GCTTTCCTGATGCCTGGCAGTGG + Intergenic
1084820648 11:71687482-71687504 GCTTCTTTGGTTGCTGGCAGTGG + Intergenic
1085135918 11:74087970-74087992 GCCTCCATCTTACCTGCCAGTGG - Intronic
1085233679 11:74994489-74994511 GCTTCCTTCTATCCTTGCAGAGG + Exonic
1090384122 11:126346752-126346774 GCTTCCTGGTTCTCAGGCAGGGG - Intergenic
1092422468 12:8343345-8343367 GCTTCTTTGGTTGCTGGCAGTGG - Intergenic
1093460354 12:19402310-19402332 GCTTCCTGCTGACCTGGCAAGGG - Intergenic
1095565311 12:43616358-43616380 GCTTCCTTGTACACTGGCGGAGG - Intergenic
1100667139 12:96767423-96767445 GCTTTCTTGTTCCGTGTCAGTGG + Intronic
1105471801 13:20701938-20701960 GCTGCCATGTTACCAGACAGTGG + Intergenic
1108450444 13:50557263-50557285 TCTTCCTCATCACCTGGCAGTGG - Intronic
1108800682 13:54091893-54091915 CCCTCCTTGTCACCAGGCAGGGG - Intergenic
1110711599 13:78656715-78656737 GCTTCCATGGTACCTGGGGGGGG + Intronic
1111667368 13:91286024-91286046 TTTTCCTTGATAGCTGGCAGTGG - Intergenic
1112610025 13:100946813-100946835 GACTCCTTGGTACCTGGCACAGG + Intergenic
1112686388 13:101832682-101832704 GCTTTCATGTACCCTGGCAGTGG + Intronic
1114622156 14:24102743-24102765 GGCTCCTTGTCACCTGGCAGAGG - Exonic
1116473589 14:45313977-45313999 GCTACCTTGTTCCCTGGAAGTGG + Intergenic
1116686065 14:48040342-48040364 GCTTACTTGGTTACTGGCAGTGG + Intergenic
1117620130 14:57577041-57577063 GCTTCCATGCTTCCTGGAAGAGG - Intronic
1118996357 14:70840215-70840237 GCTTCCATCTGACATGGCAGGGG - Intergenic
1125004982 15:34807032-34807054 GCTCCATTGTTACCAGGGAGTGG - Intergenic
1126244721 15:46490678-46490700 CCTTCCTGCTTTCCTGGCAGGGG - Intergenic
1128034561 15:64512921-64512943 GCTTGCTTATTACCTGGATGAGG - Intronic
1128225447 15:65998356-65998378 GTGTCTTTCTTACCTGGCAGGGG - Intronic
1129168524 15:73793609-73793631 GCTTACAGGTTAGCTGGCAGAGG - Intergenic
1130870622 15:87969032-87969054 AATACCTTGGTACCTGGCAGGGG - Intronic
1132730454 16:1358444-1358466 GCTTCCTTTTTATATGGCTGAGG + Intronic
1133101725 16:3484105-3484127 GCTTCCCTCTGACCTGTCAGGGG - Intronic
1133375813 16:5286256-5286278 GCTTCTTTGGTTGCTGGCAGTGG + Intergenic
1134025412 16:10949416-10949438 GAGTCGTTGTTACCAGGCAGCGG + Intronic
1140283109 16:73573604-73573626 CCTTACTTGATACCTGCCAGTGG - Intergenic
1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG + Intronic
1146222290 17:31034979-31035001 TCATCCTTGCTACCTTGCAGAGG + Intergenic
1146223354 17:31045678-31045700 GCTTTGGTGTTACCTGGCATAGG - Intergenic
1146344890 17:32053075-32053097 TCATCCTTGCTACCTTGCAGAGG - Intronic
1146351164 17:32095330-32095352 GCTTTGGTGTTACCTGGCATAGG - Intergenic
1146787571 17:35732510-35732532 CCTTCCTTCTTTCCAGGCAGAGG - Intronic
1148087997 17:45006294-45006316 GCTTCCTTCGTTCCTGGGAGGGG + Intergenic
1148173676 17:45546073-45546095 GCTTTGGTGTTACCTGGCATAGG - Intergenic
1148275593 17:46299375-46299397 GCTTTGGTGTTACCTGGCATAGG + Intronic
1148297702 17:46516943-46516965 GCTTTGGTGTTACCTGGCATAGG + Intronic
1148362251 17:47021431-47021453 GCTTTGGTGTTACCTGGCATAGG + Intronic
1150404884 17:64892997-64893019 GCTTTGGTGTTACCTGGCATAGG - Intronic
1151755723 17:76074414-76074436 GCTTCCCTGCAGCCTGGCAGGGG - Intronic
1151997228 17:77617756-77617778 GCGTCCTTGTCACCAGACAGAGG - Intergenic
1152051827 17:77985219-77985241 GTTTCCTTGCTAGCTGTCAGAGG + Intergenic
1152340740 17:79722730-79722752 GGCTCCTTGTTACCTGGGTGGGG - Intergenic
1152885937 17:82849463-82849485 TCTTCCTTGTTTCCTCGCTGTGG + Intronic
1157648637 18:49304211-49304233 GGTTCCTTATATCCTGGCAGGGG - Intronic
1159995225 18:74957939-74957961 GCTTCCTTGTTACCTGGCAGAGG + Intronic
1160081489 18:75731461-75731483 GCTTGCTTGATACCTGTCATGGG - Intergenic
1161534956 19:4813268-4813290 GCTTCCATGTGGCCTGGCAATGG + Intergenic
1163650361 19:18514115-18514137 GCCTCCATCTGACCTGGCAGTGG - Intronic
1164978930 19:32598100-32598122 GCATCCTTGCTTCCTAGCAGTGG + Exonic
1167315492 19:48760676-48760698 GCTTCCTTCCTACCAGGAAGTGG - Intergenic
1168298449 19:55389426-55389448 GGATCCTTGGTCCCTGGCAGTGG - Intronic
1168524847 19:57080619-57080641 GTTTGCTTGTGACCAGGCAGAGG - Intergenic
926924675 2:17975584-17975606 GCTTTCAGGTTACCTAGCAGAGG + Intronic
930992960 2:57682753-57682775 GCTGCCTTCTCACATGGCAGAGG - Intergenic
931862605 2:66372022-66372044 GCTTCCTGGAAACCTTGCAGGGG + Intergenic
931909748 2:66885896-66885918 GCTTCATTGTTCTCTGGCAAAGG + Intergenic
932614004 2:73220430-73220452 TCTTCCTGGGGACCTGGCAGGGG + Intronic
932844658 2:75122936-75122958 TCTTCCTTGATGCCTGACAGTGG + Intronic
933424091 2:82087754-82087776 AATTCTATGTTACCTGGCAGAGG - Intergenic
935014648 2:99169125-99169147 GCTTCTCTGTTACTTGGCTGCGG - Intronic
939622430 2:144436605-144436627 GGTTCCCTGGTACCTGGGAGAGG + Intronic
942446992 2:176084785-176084807 GCTTTCTTGCTACGTGGCCGCGG + Intergenic
942862668 2:180635320-180635342 GCTTCCCTGTCCCCTAGCAGTGG + Intergenic
943025450 2:182622663-182622685 GCTTCCTACTGACCTGGGAGTGG - Intergenic
945442723 2:209899555-209899577 GCTTCTTTGTTGTCTGCCAGAGG - Intronic
947414734 2:229883072-229883094 GTTTTATTGATACCTGGCAGAGG - Intronic
948215943 2:236231452-236231474 GCTGCATTGTCACATGGCAGAGG - Intronic
1168959496 20:1859131-1859153 GCTTCCTTTTTAACTAGGAGTGG + Intergenic
1171295352 20:24012395-24012417 GCTTCCTGCTCAACTGGCAGGGG - Intergenic
1171455840 20:25271705-25271727 ACTTCCCTGTCACCAGGCAGAGG - Intronic
1172839276 20:37892425-37892447 GGCTCCTTGTTTCCTAGCAGAGG - Intergenic
1178851835 21:36218783-36218805 GCTTCCCTGCAACCAGGCAGGGG - Intronic
1181473712 22:23156167-23156189 GCTTCCCTGTTCCCAAGCAGTGG - Intronic
1184698351 22:46151660-46151682 CCTCCCTGGTTTCCTGGCAGGGG - Intronic
1184895951 22:47406552-47406574 GCTTCCCTTTTACGTGTCAGTGG + Intergenic
1185095656 22:48804691-48804713 GCTTTCTTGTCACCAGGAAGGGG - Intronic
953109767 3:39922543-39922565 GCCTCATTGTTACTGGGCAGTGG - Intronic
955817352 3:62859671-62859693 CCTTCCTGTTTGCCTGGCAGTGG - Intronic
956063123 3:65368908-65368930 GGTTCCATGTTACCTGGCTCAGG + Intronic
957066259 3:75524938-75524960 GCTTCTTTGGTTGCTGGCAGTGG - Intergenic
957590964 3:82197195-82197217 TCCTCCTTGTTTCCTGTCAGTGG - Intergenic
959104080 3:102046399-102046421 GGTTCCTTGTTAAATGGCAGTGG + Intergenic
961286884 3:125813102-125813124 GCTTCTTTGGTTGCTGGCAGTGG + Intergenic
961391872 3:126557246-126557268 GCTTCCTTGGTCCAAGGCAGAGG + Intronic
961737916 3:129013913-129013935 GCTTCTTTGTGACTAGGCAGGGG + Intronic
962308870 3:134312120-134312142 GCTCCTTTCCTACCTGGCAGGGG - Intergenic
963020814 3:140871519-140871541 CCTTCCTTGTTATCTGGAAGTGG - Intergenic
969010872 4:4061018-4061040 GCTTCTTTGGTTGCTGGCAGTGG - Intergenic
969743197 4:9048873-9048895 GCTTCTTTGCTTGCTGGCAGTGG + Intergenic
969802577 4:9580967-9580989 GCTTCTTTGGTTGCTGGCAGTGG + Intergenic
973601775 4:52549428-52549450 TCTTCCTGGTTCCCTGGCAGAGG - Intergenic
974520987 4:62979419-62979441 TCTACTTTGTTACCTTGCAGCGG + Intergenic
980280409 4:130711349-130711371 CCTTCCTTCTTTCCTTGCAGGGG + Intergenic
980986144 4:139696484-139696506 TCTTCCTTATCATCTGGCAGTGG + Intronic
985651764 5:1111004-1111026 GCCTCCCTGCTCCCTGGCAGTGG - Intronic
985987586 5:3529660-3529682 ACTTCCTTCTTCCCAGGCAGAGG + Intergenic
986631319 5:9776306-9776328 CCTCCCCTATTACCTGGCAGTGG - Intergenic
986851530 5:11818803-11818825 GGCTCCATGTTACCTGGCAGAGG - Intronic
987382624 5:17299913-17299935 GTTTCCTTCTTACCTGGGAATGG + Intergenic
988037706 5:25850013-25850035 TAGTCCTTGTTACCTGGCATAGG - Intergenic
992187348 5:74257173-74257195 TCTTCCTGCTTACATGGCAGAGG - Intergenic
992552129 5:77868885-77868907 GCTTCCATGCCACCTAGCAGGGG + Intergenic
993056429 5:82985940-82985962 GCTTCCTTGTGGTCTGGCCGTGG + Intergenic
995145743 5:108785705-108785727 GCTTCCTTGATATTTGTCAGAGG + Intronic
1000560153 5:162777383-162777405 GCTTCATTATTGCCAGGCAGTGG + Intergenic
1001020668 5:168179851-168179873 GCTTCCTGGGTGCCTGGCACTGG - Intronic
1003790752 6:9544664-9544686 GCTTTCTTTTTACCTGTCTGTGG - Intergenic
1006847828 6:37075112-37075134 CCTTCCATTATACCTGGCAGTGG + Intergenic
1007408140 6:41646487-41646509 GCTTCCTAGTCACTTTGCAGTGG - Intronic
1010596391 6:77769139-77769161 CCTTCCCTATTCCCTGGCAGCGG + Intronic
1011022894 6:82834106-82834128 GCTTACTTGTTACCTATCTGGGG + Intergenic
1011722709 6:90175888-90175910 GCTTGCTTGGTACCTGGCTGTGG - Intronic
1012743555 6:103053632-103053654 GCTGTCTTGCTACTTGGCAGGGG + Intergenic
1013413373 6:109902178-109902200 TCTTTCTTGTTACCTAGCAAAGG - Intergenic
1013817621 6:114117678-114117700 GGTTTCTTTTTACTTGGCAGAGG - Intronic
1017585765 6:155920973-155920995 GCCCACTTGGTACCTGGCAGAGG + Intergenic
1022472133 7:30688570-30688592 GTCTCCTTGTGCCCTGGCAGTGG + Intronic
1023841806 7:44102362-44102384 GCTTCTATTTTCCCTGGCAGAGG + Intergenic
1026390986 7:69901296-69901318 GCTTCCTTCTTACCCTGCTGGGG - Intronic
1028394161 7:90348913-90348935 TCTTCCTTGTTATCTGGCACTGG + Intronic
1028986968 7:97016793-97016815 GCTTCCTTGTATTCTGGGAGAGG - Intergenic
1033543900 7:142382231-142382253 GATTCATTGTACCCTGGCAGAGG + Intergenic
1034786907 7:153934752-153934774 GCTTCCTCGTTTCCTGCAAGTGG - Intronic
1035843169 8:2834482-2834504 GATGCCTTGTTACCTGTGAGAGG + Intergenic
1036083959 8:5592238-5592260 GTTTCTTTGTTCCCAGGCAGAGG - Intergenic
1036248403 8:7140659-7140681 GCTTCTTTGGTTGCTGGCAGTGG + Intergenic
1036252405 8:7173678-7173700 GCTTCTTTGGTTGCTGGCAGTGG - Intergenic
1036365089 8:8113782-8113804 GCTTCTTTGGTTGCTGGCAGTGG + Intergenic
1036885837 8:12552306-12552328 GCTTCTTTGGTTGCTGGCAGTGG - Intergenic
1036893456 8:12611384-12611406 GCTTCTTTGGTTGCTGGCAGTGG - Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1039870288 8:41540194-41540216 GCTTCCTTGTTCCCTGGGGTGGG + Intronic
1044221002 8:89669548-89669570 GCTTCATTGGAACCTGGAAGTGG - Intergenic
1044412692 8:91901963-91901985 GCTCCCTTGTTTCCTGGGACAGG + Intergenic
1048471998 8:134712458-134712480 GCTTCCTTCTTGCCTGGCCTCGG - Intronic
1049127703 8:140807051-140807073 GCTTCCTTGTAATCTGGTGGTGG - Intronic
1049955158 9:686368-686390 GTCTTCTTGTGACCTGGCAGAGG + Intronic
1051158370 9:14176452-14176474 CATTCTTTGTTACGTGGCAGGGG - Intronic
1053364933 9:37516073-37516095 GGTTCTTTATTACCTGGGAGAGG + Exonic
1055538561 9:77276712-77276734 GTTTCCTTGTTGCCTGTTAGCGG + Intronic
1057111773 9:92478949-92478971 TGTTCCTTGTGGCCTGGCAGCGG + Intronic
1057926047 9:99150714-99150736 GCACCCTTGTTACTTGGGAGAGG + Exonic
1058876169 9:109246731-109246753 CCTTCCATGTTACCAGGCATGGG + Intronic
1061991516 9:134161829-134161851 TGTTCCCTGTAACCTGGCAGTGG + Intergenic
1062168694 9:135122302-135122324 GCTCCCTTGTTACCTGGCCCTGG + Intergenic
1188199843 X:27284343-27284365 GGTTCCTTGGTTCCTGGCATTGG - Intergenic
1189367085 X:40397201-40397223 GCTTCCCTGTTACCAGGTATTGG + Intergenic
1190447649 X:50545440-50545462 GTTTCCTGTTTACCTAGCAGAGG + Intergenic
1191250450 X:58257653-58257675 GCTTCCTTGCTGCCTTGGAGTGG - Intergenic
1200750291 Y:6938644-6938666 GCTTCCTTGGTTCCTTCCAGTGG + Intronic