ID: 1160001754

View in Genome Browser
Species Human (GRCh38)
Location 18:75031069-75031091
Sequence AACTGCTGCTATGTGTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160001754 Original CRISPR AACTGCTGCTATGTGTATGG GGG (reversed) Intronic
901471530 1:9460022-9460044 CACTGCTGCTTTGAGGATGGAGG - Intergenic
902145336 1:14394120-14394142 TACTGCTGGCATGTGTGTGGGGG - Intergenic
908313271 1:62906875-62906897 AGCTGCTGCAATGTGTCTGTGGG - Intergenic
909811550 1:79937588-79937610 TAGTCATGCTATGTGTATGGGGG + Intergenic
909913453 1:81289308-81289330 AACTCCTGCTATGTGAACTGTGG + Intergenic
911581075 1:99634110-99634132 AACTGTTGCTATGTCTTTCGTGG - Intergenic
912165220 1:107035575-107035597 GACTGATGCTAAATGTATGGAGG - Intergenic
913039293 1:115007337-115007359 AACTGCTGCTCTTTGCATGATGG + Intergenic
914015977 1:143818823-143818845 AACTCCAGGTATGGGTATGGCGG + Intergenic
914161805 1:145142185-145142207 AACTCCAGGTATGGGTATGGCGG - Intergenic
916487648 1:165273598-165273620 AAGTGCTGAAATGTGTTTGGTGG - Intronic
917784233 1:178435401-178435423 ATCTGCTGTTATGTGAATGTTGG + Intronic
918185701 1:182125552-182125574 TAATGCTGCAATGAGTATGGGGG - Intergenic
918998080 1:191789011-191789033 AACTGCTGCTACCTGGAGGGTGG + Intergenic
920074194 1:203325054-203325076 AACTGTTGCCATCTGTCTGGTGG + Intergenic
923197261 1:231680411-231680433 ACCTGCTGCTATATGCACGGGGG - Intronic
923367327 1:233275706-233275728 TAATGCTGCTATGTACATGGGGG - Intronic
1064648404 10:17483559-17483581 AACTTCTCCTGTGTGTATGCAGG - Intergenic
1073734979 10:106335558-106335580 AACTGGTGCTATTTGCATTGAGG - Intergenic
1073735273 10:106337825-106337847 AACTGGTGCTATTTGCATTGAGG + Intergenic
1078730326 11:13967990-13968012 AACAGCTTATCTGTGTATGGGGG - Intronic
1083901428 11:65645379-65645401 AGCTGCTGGAATGTGTTTGGTGG - Intronic
1085094723 11:73750770-73750792 TAATGCTACTATGAGTATGGGGG + Intronic
1089314469 11:117582197-117582219 AGCTGCTGCTTTGTGGATGTTGG + Intronic
1097972913 12:65653730-65653752 AACTCCTGATGTGTGTATGCAGG + Intergenic
1099407144 12:82278544-82278566 AACTGCAGGTATGTTTCTGGTGG - Intronic
1101964421 12:109272735-109272757 TACTGCTGCTATGAAAATGGGGG + Intergenic
1103086658 12:118066683-118066705 CACTGCTGTCATCTGTATGGGGG + Exonic
1105301509 13:19139514-19139536 AACTGCTCCACTGTGTAGGGTGG + Intergenic
1107895103 13:44954187-44954209 AATTGCTGCTATCTCTATGCTGG - Intronic
1108153502 13:47561253-47561275 AGCTGCTGGTCTGAGTATGGAGG - Intergenic
1112824099 13:103371927-103371949 ATCTTCTGCTATGTATATGGTGG + Intergenic
1116468340 14:45258564-45258586 GACTCCTGTAATGTGTATGGTGG + Intergenic
1118720842 14:68592817-68592839 AACAGCTCCTATGTGTGTGCAGG + Intronic
1119477691 14:74940515-74940537 ATATGCTGCTATATGTATTGGGG - Intergenic
1121739669 14:96242626-96242648 AAATGCTCCTGTGTGTGTGGCGG - Exonic
1124913562 15:33946711-33946733 ACCTGCTGCTCTCTGTCTGGAGG - Intronic
1126384679 15:48082232-48082254 ACCTGCTGCTATTTTTATTGGGG + Intergenic
1128383373 15:67129885-67129907 AAGTGCTGCCATGTGGCTGGTGG + Intronic
1129528264 15:76237578-76237600 AACTGCTGTTATGTGTAAAATGG + Intronic
1133619218 16:7510264-7510286 AACAGCTGCTAAGTTTATGGAGG + Intronic
1135250634 16:20899030-20899052 AGCTGATTCTTTGTGTATGGGGG - Intronic
1135560215 16:23470380-23470402 AACTGGTGGTGTGTGTATGATGG - Intronic
1137344264 16:47640117-47640139 TACTGCTGATATATGTATGCTGG + Intronic
1141261328 16:82456437-82456459 AACACCTACTATGTGTATTGAGG - Intergenic
1142665266 17:1459378-1459400 AACTGCTCCTATGTGAATGCTGG + Intronic
1142736767 17:1905876-1905898 AATTTTTGCTGTGTGTATGGGGG + Intergenic
1147870779 17:43585988-43586010 AACTCGTCCTAGGTGTATGGTGG + Intergenic
1149280144 17:55094767-55094789 GATTGCTGCTATGTATCTGGTGG - Intronic
1151536793 17:74743489-74743511 ATCTGCTGCTTTGTATTTGGTGG + Intronic
1153526703 18:6001810-6001832 AACTCCTGCAATGTGTATATTGG - Intronic
1154171509 18:12056387-12056409 AAATGCTGCTATGGGTGAGGTGG - Intergenic
1155315206 18:24564389-24564411 AGCTTCTGCTATGTGTTTGGAGG + Intergenic
1157120892 18:44910227-44910249 AACAGCAGCAATGTGTATGATGG - Intronic
1157502081 18:48198332-48198354 AACTGATGCAGTGTGTCTGGAGG - Intronic
1160001750 18:75031040-75031062 ACCTGCTGCTATGTGTGTGGGGG - Intronic
1160001754 18:75031069-75031091 AACTGCTGCTATGTGTATGGGGG - Intronic
1160076139 18:75679517-75679539 AGCTGCTGCTGTGTGTTTGTTGG + Intergenic
1161627095 19:5333616-5333638 ACCTGCTGCTTTGTGGCTGGAGG - Intronic
925179948 2:1811090-1811112 AACTGCTGCTCTCTGGTTGGTGG - Intronic
925292230 2:2755639-2755661 AACATCTGCTATGTGAATGCTGG + Intergenic
925935951 2:8759966-8759988 CTCTGCTGCTATGTCTGTGGTGG - Intronic
926662318 2:15481271-15481293 CACTGCTGCTATGAATATGTAGG + Intronic
926802521 2:16671566-16671588 AACTGCTGTTAGGTGTGAGGAGG - Intergenic
926827914 2:16926995-16927017 AACTGCTGCTATTCATATGTTGG - Intergenic
927047865 2:19298065-19298087 AACTGCTGCTTTGTGGTTTGGGG - Intergenic
927110192 2:19859010-19859032 GTCTGCTGCCCTGTGTATGGAGG - Intergenic
927450560 2:23205994-23206016 ACCTGCTGCTGTGTGGGTGGTGG - Intergenic
927509985 2:23638502-23638524 TACTGCTCCTAGGTGGATGGTGG - Intronic
931255334 2:60567150-60567172 AACTGCTGTTTTGTGCATGCTGG - Intergenic
932573128 2:72948695-72948717 ACCTGCTGCCCTGTGTGTGGCGG - Intronic
937933717 2:127225730-127225752 AACTGCTGCTAAGTCTTTGCTGG - Intergenic
939060985 2:137421215-137421237 ATCTGCTGCTGGGTGTGTGGGGG - Intronic
939662658 2:144909527-144909549 AACTGCTGCAATAAATATGGGGG - Intergenic
940438981 2:153691691-153691713 ACCTTCTGGTATGTGTATAGTGG - Intergenic
940974841 2:159931147-159931169 AACTGGTGCTAAGCGTATGAGGG - Intergenic
941839393 2:170063992-170064014 AACTGCTGGCAAGTATATGGGGG - Intronic
948637266 2:239347407-239347429 AGCTGCTTTTATGTGGATGGGGG + Intronic
1169571198 20:6908034-6908056 AACTGTTCCAGTGTGTATGGGGG + Intergenic
1170474097 20:16697704-16697726 AACTCCTGATATGTATTTGGAGG + Intergenic
1177644145 21:23880674-23880696 GACTGCTGTTATGGGTTTGGGGG + Intergenic
1177833009 21:26160255-26160277 AACTGCTGCTAGTTGAATTGTGG - Intronic
1181036837 22:20173845-20173867 AACTGCTGCTCTGCGGATGAGGG - Intergenic
1181504552 22:23343483-23343505 AACTTGTGTTATGTGTATGTTGG + Intergenic
1184522622 22:45004365-45004387 AACTCCAGCTGTGTGTGTGGGGG + Intronic
1184820759 22:46907803-46907825 AGCTGCTGCTTTGGGTAGGGAGG + Intronic
950898156 3:16472544-16472566 AACTTCTGACAGGTGTATGGTGG + Intronic
954428823 3:50458377-50458399 AACTGCTGCCCTGTACATGGGGG - Intronic
955643195 3:61109115-61109137 AAATGCTGTTAAGTGTATAGAGG + Intronic
956047791 3:65214898-65214920 AAATGCTGCTCTTTCTATGGTGG - Intergenic
956590225 3:70906900-70906922 AACAGCTGCTATGGGTATCAAGG - Intergenic
958961957 3:100519186-100519208 AGCTGTTGCAATGTGTATGCTGG + Intronic
959024838 3:101229323-101229345 TACTGCTGGTGTGTGTGTGGGGG - Intronic
960753480 3:120982669-120982691 CACTGCTGCTTTGTATATAGAGG + Intronic
960991021 3:123311418-123311440 ACCTCCTGCCATGTGCATGGCGG - Intronic
963661535 3:148133169-148133191 AACCGCTGCCATGTGCATGATGG - Intergenic
963918543 3:150883841-150883863 TACTGCTGCTTTGTGTTTTGGGG - Intronic
964232664 3:154488478-154488500 ATCTGATGCTATGTGTCTTGGGG - Intergenic
967621773 3:191642508-191642530 GACTGCTCCTCTCTGTATGGTGG - Intergenic
967826301 3:193880324-193880346 AACTGCTGTAGTGTGTGTGGGGG + Intergenic
969314020 4:6370790-6370812 AACTGCTGCTATGAGCACTGTGG + Intronic
971786365 4:31108613-31108635 CACAGCTGCTATTTTTATGGGGG + Intronic
976527092 4:86105884-86105906 AAATGCTGGTCAGTGTATGGTGG - Intronic
981573373 4:146176923-146176945 CACTGCAGCAATGTGTATGAAGG - Intronic
987055710 5:14189469-14189491 AACTGCTGTTATTTGTATTTGGG - Intronic
987521723 5:18994244-18994266 AGCTGCTGCTATGTTTGAGGAGG - Intergenic
988277099 5:29095691-29095713 ACATGCTGCTATCTGTATGTAGG - Intergenic
992791646 5:80219488-80219510 AACAGCGGCTATTTGTTTGGGGG - Intronic
995957558 5:117796379-117796401 AATTTTTGCCATGTGTATGGAGG - Intergenic
999320857 5:150614290-150614312 TTCTGCTGCTGTGTGTGTGGTGG - Intronic
999424660 5:151476749-151476771 AACTGCTGGTACGTGGAGGGAGG + Exonic
1001095826 5:168774864-168774886 AACTGCATCTATGTGTAGGCAGG + Intronic
1001468495 5:171990413-171990435 AATTGCTGCAATGTGACTGGAGG + Intronic
1002701986 5:181130824-181130846 AAGTGCTGATGTGTGTGTGGGGG - Intergenic
1003640104 6:7869113-7869135 AGCTGCTGCTGTGAGTATGACGG - Intronic
1006266559 6:32930281-32930303 TAGTGCTGCTATGAATATGGGGG - Intergenic
1006378796 6:33685933-33685955 CACTGCTGCTTTGTGGCTGGTGG + Intronic
1007164541 6:39819901-39819923 ATCTGATGCTATGTGTAGGCGGG - Intronic
1015032846 6:128616636-128616658 AACTTCTGCAATGTGTATGTTGG + Intergenic
1015124125 6:129733571-129733593 AACTGCTGCTTTGTAGATGAGGG - Intergenic
1018174058 6:161163947-161163969 AACTAATGCTGTGTGTAAGGGGG - Intronic
1021550074 7:21861772-21861794 AACTGTTGCCCTGTGTATCGGGG + Intronic
1021944456 7:25712791-25712813 AACAGCTGCTATGCATATGCAGG - Intergenic
1025237133 7:57242279-57242301 TAATGCTGCTATGAGCATGGGGG + Intergenic
1025934315 7:66022572-66022594 TAATGCTGCTATGAGCATGGGGG - Intergenic
1032558893 7:132867009-132867031 AAATGATGGTATGTGTATGGTGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034098109 7:148427720-148427742 AACTGATGATATGTGTCTTGGGG - Intergenic
1035578939 8:727929-727951 GCCTGCTGCTGTGTGTGTGGTGG - Intronic
1045633667 8:104157764-104157786 TAATGCTACTATGTATATGGGGG + Intronic
1046243238 8:111526521-111526543 AAGTGCTGCCCTGTGTCTGGGGG + Intergenic
1056748972 9:89331579-89331601 TAATGACGCTATGTGTATGGGGG - Intronic
1057688517 9:97261027-97261049 AAGTGATGGTATGTGTATGTGGG - Intergenic
1059203242 9:112438438-112438460 CACTGCTGCTATGGATATGCTGG + Exonic
1059483428 9:114609907-114609929 CAATGCTGCTATGTGTATCAGGG + Intergenic
1061927157 9:133811541-133811563 AGCAGCTGCTATGTGGAAGGTGG - Intronic
1188062178 X:25614855-25614877 TACTGCTGCTATTGTTATGGAGG + Intergenic
1190970466 X:55342875-55342897 CGCTGCTGCTCTGTGTAGGGTGG - Intergenic
1191896945 X:66002692-66002714 GTCTGCTGCTTTGTGTGTGGGGG + Intergenic
1192780555 X:74290212-74290234 AACTGCTGAGATATATATGGAGG + Intergenic
1192832990 X:74769595-74769617 TACTGCTGCAATGTGTCTGATGG + Intronic
1198020101 X:132649221-132649243 AACTGCTGCTCTGGGAGTGGAGG + Intronic
1198574405 X:137994200-137994222 TACTGCTGCTCTGTGGGTGGTGG + Intergenic