ID: 1160001882

View in Genome Browser
Species Human (GRCh38)
Location 18:75032510-75032532
Sequence TCTTCTCTCGACTCTAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160001876_1160001882 0 Left 1160001876 18:75032487-75032509 CCTTATAGCCCACCAACCTTCTC 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1160001882 18:75032510-75032532 TCTTCTCTCGACTCTAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 103
1160001877_1160001882 -8 Left 1160001877 18:75032495-75032517 CCCACCAACCTTCTCTCTTCTCT 0: 1
1: 0
2: 6
3: 80
4: 736
Right 1160001882 18:75032510-75032532 TCTTCTCTCGACTCTAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 103
1160001878_1160001882 -9 Left 1160001878 18:75032496-75032518 CCACCAACCTTCTCTCTTCTCTC 0: 1
1: 1
2: 8
3: 138
4: 1167
Right 1160001882 18:75032510-75032532 TCTTCTCTCGACTCTAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160001882 Original CRISPR TCTTCTCTCGACTCTAAGGT AGG Intronic
903295152 1:22339062-22339084 ACTTCTCTGGACTCCAGGGTTGG - Intergenic
903428093 1:23269836-23269858 TTTTCCCTAGACTCTATGGTAGG + Intergenic
908298140 1:62733701-62733723 TCTTATCTCCACCCTCAGGTAGG + Intergenic
908961466 1:69701338-69701360 TCTTCACTAGACCCTTAGGTCGG + Intronic
909343639 1:74559794-74559816 TCTTATTTCGACTCCAAGGCAGG - Intergenic
912146619 1:106801938-106801960 TCTTTTCTAGACTCTAATGTGGG - Intergenic
912943144 1:114062442-114062464 GCTACTCTGGAGTCTAAGGTGGG - Intergenic
919858754 1:201724423-201724445 TCTTCTCCCTACTTTAATGTGGG + Intronic
922720588 1:227898363-227898385 TCACCTCTCGACTCTGAGGTGGG + Intergenic
1062839829 10:661611-661633 TCTTCTCTGGACTCTAAGCAGGG + Intronic
1063498017 10:6527972-6527994 TCTTCTCCTGACTCTGAGGCAGG + Intronic
1068137804 10:52967583-52967605 TCATCTATTGTCTCTAAGGTTGG - Intergenic
1068667390 10:59691507-59691529 TCTTCTCTCTCCTCCAAGGGAGG - Intronic
1069214443 10:65802124-65802146 TCTTCTTTCTACTCTAAAGTTGG + Intergenic
1073609887 10:104932802-104932824 GCTACTCTTGACTCTGAGGTAGG - Intronic
1075242312 10:120790367-120790389 TCTTGTCTCTACTCTGAGGAAGG - Intergenic
1077785565 11:5380069-5380091 TCTTCTCCCCACTCCAAGTTGGG - Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1079426808 11:20351364-20351386 TCTACTTTCAACTCTAAGGCTGG - Intergenic
1084920273 11:72464142-72464164 TCTGCTCTCAAGTCTAAGGGTGG - Intergenic
1086751670 11:90502836-90502858 TAATCTCTTGACTCTAAGGATGG - Intergenic
1087389457 11:97515191-97515213 TCTTCTCTTGATTCACAGGTGGG + Intergenic
1091788435 12:3257115-3257137 TCTGCTCTTGCCTATAAGGTTGG - Intronic
1092847408 12:12596589-12596611 TCCTCTCTCTCCTCTAGGGTAGG + Intergenic
1097168398 12:57098366-57098388 TCTTCTGTCCACTCTAATGAGGG - Intronic
1106210429 13:27638200-27638222 TCATCTCTTGCCTCTAAGGCAGG + Intronic
1109429596 13:62213740-62213762 TCTTTTCCCCAATCTAAGGTGGG - Intergenic
1110350496 13:74501916-74501938 TCTACTCTCCACTCCGAGGTAGG + Intergenic
1110977374 13:81856420-81856442 TCTTCTTTAGACTTTGAGGTAGG - Intergenic
1111288106 13:86121961-86121983 TCGTCTCTTGATTCTTAGGTTGG + Intergenic
1111412941 13:87900018-87900040 TCTACTCTCCACTTTCAGGTAGG - Intergenic
1117545491 14:56791573-56791595 TCTTCCTTGGACTGTAAGGTAGG - Intergenic
1126307170 15:47273041-47273063 TCTTTACTCGCCTGTAAGGTTGG + Intronic
1128744335 15:70103074-70103096 TCTCCTCTGGACTCTCAGGAAGG + Intergenic
1131575365 15:93584804-93584826 TCCTCTCCCTACCCTAAGGTGGG + Intergenic
1135623779 16:23978035-23978057 TCTTATCTCCATTCTAAGATTGG + Intronic
1139176115 16:64690025-64690047 TATTCTGTCAAATCTAAGGTAGG - Intergenic
1140902970 16:79386793-79386815 TCTTCTTTTGGCTCTAAGGATGG - Intergenic
1141804212 16:86332103-86332125 TCATCTCCCTACTTTAAGGTCGG + Intergenic
1149626235 17:58082978-58083000 TCTCCTCCCCTCTCTAAGGTTGG + Intergenic
1152099868 17:78294727-78294749 TATTCTCCCGACTTTAAGGAGGG - Intergenic
1154486788 18:14878448-14878470 TTCTTTCTCGATTCTAAGGTTGG + Intergenic
1156963881 18:43066707-43066729 TCTTCTCTGGCCTCCAAGTTAGG - Intronic
1157909771 18:51604797-51604819 TCATCTATTGTCTCTAAGGTCGG - Intergenic
1160001882 18:75032510-75032532 TCTTCTCTCGACTCTAAGGTAGG + Intronic
1161095121 19:2385737-2385759 TCTACTCTGGAATCTAAGGCAGG + Intergenic
1164738218 19:30558206-30558228 TTTTCTATCCACTCTTAGGTGGG + Intronic
1164940421 19:32248777-32248799 TCTTCTTCCCACTCTGAGGTTGG - Intergenic
1168678324 19:58295161-58295183 TCTCATCTTGACTCAAAGGTGGG - Exonic
929384352 2:41386221-41386243 TTTTCTCTAGGCTGTAAGGTGGG - Intergenic
929728564 2:44460181-44460203 TCTTCTGTTAACTATAAGGTGGG - Intronic
930546495 2:52773935-52773957 TCCTCCCTCGACCCTCAGGTCGG - Intergenic
934717356 2:96551613-96551635 TCTTCTCTAGACTTAAAGATGGG + Exonic
936463677 2:112728931-112728953 TCATCTCTGGACTCTTAGATGGG + Intronic
937486086 2:122316281-122316303 TCTGCTCTGGACTCCAAGATGGG + Intergenic
941247404 2:163116528-163116550 TCTTGTCTTGAAACTAAGGTTGG - Intergenic
948522154 2:238546685-238546707 TCTTGTATCGTCTCTGAGGTGGG - Intergenic
1169423604 20:5479142-5479164 GCTTCTCTGGATACTAAGGTGGG - Intergenic
1174688263 20:52476535-52476557 TGTTCTTTCAACTCTAAGCTTGG + Intergenic
1175682664 20:61002065-61002087 TCTTATCTCGACATGAAGGTGGG + Intergenic
1176794511 21:13360950-13360972 TTCTTTCTCGATTCTAAGGTTGG - Intergenic
1178668513 21:34569758-34569780 TCTTATCTTGGCTCTGAGGTAGG + Intronic
1179181733 21:39051153-39051175 TCTTCACTCCACTTTAAGTTTGG + Intergenic
1182531919 22:30966972-30966994 TATACTCTCGACTCTGAAGTGGG + Intronic
1182739732 22:32558877-32558899 TCTTCTCTCCAGTCAGAGGTGGG - Intronic
949510238 3:4760868-4760890 TCATCTGTCTACTTTAAGGTCGG + Intronic
951745879 3:25976845-25976867 TCTCTTTTAGACTCTAAGGTAGG + Intergenic
953699936 3:45187652-45187674 TATTCACTCCACTCTCAGGTGGG + Intergenic
954535614 3:51357342-51357364 TATTCTCTGAACTCTAAGATGGG + Intronic
958127399 3:89374847-89374869 TTTTCTGTCTACTCTAAGTTGGG - Intronic
967851706 3:194087547-194087569 TCTATTCTCGTCTCTCAGGTTGG + Intergenic
969896525 4:10310334-10310356 TCTTCTCCCTACACAAAGGTAGG - Intergenic
970333207 4:15004420-15004442 GCTTCTCTCGGGGCTAAGGTCGG - Intronic
970678873 4:18484417-18484439 TCTTCTCCTGCCTCTAAGTTGGG + Intergenic
975036081 4:69684500-69684522 TCCTCCCTCCACTCTCAGGTGGG + Intergenic
983957255 4:173712368-173712390 TCATCTCTCTACTATTAGGTCGG - Intergenic
987694356 5:21308813-21308835 TCCTCCCTCCACTCTAAAGTAGG - Intergenic
987983042 5:25113193-25113215 TCTACTCTCCACTCTCAAGTAGG - Intergenic
989169772 5:38462602-38462624 TCCTCTCTCTAGTCTAAGTTAGG + Intronic
991350092 5:65712153-65712175 GCTACTCACGAGTCTAAGGTGGG + Intronic
991745887 5:69740658-69740680 TCCTCCCTCCACTCTAAAGTAGG + Intergenic
991751816 5:69814575-69814597 TCCTCCCTCCACTCTAAAGTAGG - Intergenic
991797488 5:70320616-70320638 TCCTCCCTCCACTCTAAAGTAGG + Intergenic
991825265 5:70615972-70615994 TCCTCCCTCCACTCTAAAGTAGG + Intergenic
991831106 5:70689476-70689498 TCCTCCCTCCACTCTAAAGTAGG - Intergenic
991889830 5:71319937-71319959 TCCTCCCTCCACTCTAAAGTAGG + Intergenic
992834032 5:80622548-80622570 TCTTCTCTTGATTTTAAGGTGGG - Intergenic
996977929 5:129457551-129457573 TCTTTTCTTTCCTCTAAGGTTGG + Intergenic
1001264310 5:170261615-170261637 TCTTCTCTTTACACCAAGGTGGG - Intronic
1002990267 6:2231797-2231819 TTTTTTCTTGACTCCAAGGTAGG - Intronic
1013054491 6:106570222-106570244 TCTTCTCTGGAGTCTATGGTAGG + Exonic
1016838728 6:148505135-148505157 TCTTCTCTCATTTCTAAGATAGG - Intronic
1017643066 6:156513115-156513137 TCTTCTCTCCACTCACAGGTAGG - Intergenic
1024188662 7:46982286-46982308 CCATCTCTCGAAGCTAAGGTAGG + Intergenic
1025075020 7:55935532-55935554 TCTTCTGTCAACTCTCAGGGAGG - Intronic
1026223249 7:68418647-68418669 TCATCTCTCTACTCTCAGGAAGG - Intergenic
1033237876 7:139652765-139652787 CCTTCTCTCAACTCTGAAGTCGG - Intronic
1034985646 7:155512496-155512518 ACTTCTTTCCACTCTAAAGTAGG - Intronic
1035955473 8:4073266-4073288 TCTTCTTTCAACTCTAATTTTGG - Intronic
1036425260 8:8639742-8639764 TCTTGTCTGCACACTAAGGTAGG - Intergenic
1041400512 8:57438586-57438608 TTTCCTCTAGCCTCTAAGGTTGG + Intergenic
1043502202 8:80869514-80869536 TCTTCTCTCCAATCTAATGGAGG + Intronic
1053887723 9:42657223-42657245 TTCTTTCTCGATTCTAAGGTTGG + Intergenic
1054226743 9:62464673-62464695 TTCTTTCTCGATTCTAAGGTTGG + Intergenic
1055954462 9:81761117-81761139 TCTTCTCTCAAATCTCATGTTGG + Intergenic
1188233899 X:27702036-27702058 TATTTTCTCGTATCTAAGGTCGG - Intronic
1190676926 X:52790658-52790680 GCTTCTCTGGAGGCTAAGGTGGG - Intergenic
1192232000 X:69271850-69271872 TCCTCTCAAGACTCTCAGGTAGG + Intergenic
1193273895 X:79562853-79562875 TATTTTCTTGACTCTAAGATAGG + Intergenic
1195630400 X:107050026-107050048 TCTTCTCTCATCTTTAATGTTGG - Intergenic
1196057374 X:111370244-111370266 TCCTCTCAAGACTCTAAGATTGG - Intronic