ID: 1160003693

View in Genome Browser
Species Human (GRCh38)
Location 18:75052469-75052491
Sequence TGGAGGATCTTCAAGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160003693_1160003700 7 Left 1160003693 18:75052469-75052491 CCATGTCCCTTGAAGATCCTCCA 0: 1
1: 0
2: 3
3: 22
4: 199
Right 1160003700 18:75052499-75052521 CAGGCCTGTAGCTTTATTTTTGG 0: 1
1: 0
2: 0
3: 43
4: 362
1160003693_1160003705 23 Left 1160003693 18:75052469-75052491 CCATGTCCCTTGAAGATCCTCCA 0: 1
1: 0
2: 3
3: 22
4: 199
Right 1160003705 18:75052515-75052537 TTTTTGGGACTGGGAAGTTCCGG 0: 1
1: 0
2: 2
3: 19
4: 301
1160003693_1160003704 14 Left 1160003693 18:75052469-75052491 CCATGTCCCTTGAAGATCCTCCA 0: 1
1: 0
2: 3
3: 22
4: 199
Right 1160003704 18:75052506-75052528 GTAGCTTTATTTTTGGGACTGGG 0: 1
1: 0
2: 1
3: 12
4: 221
1160003693_1160003703 13 Left 1160003693 18:75052469-75052491 CCATGTCCCTTGAAGATCCTCCA 0: 1
1: 0
2: 3
3: 22
4: 199
Right 1160003703 18:75052505-75052527 TGTAGCTTTATTTTTGGGACTGG 0: 1
1: 0
2: 1
3: 37
4: 843
1160003693_1160003701 8 Left 1160003693 18:75052469-75052491 CCATGTCCCTTGAAGATCCTCCA 0: 1
1: 0
2: 3
3: 22
4: 199
Right 1160003701 18:75052500-75052522 AGGCCTGTAGCTTTATTTTTGGG 0: 1
1: 0
2: 17
3: 211
4: 1453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160003693 Original CRISPR TGGAGGATCTTCAAGGGACA TGG (reversed) Intronic
901554132 1:10018294-10018316 TGGAGGAGATGCATGGGACAAGG + Intergenic
902171911 1:14618518-14618540 TGGAGTACCTAGAAGGGACAAGG + Intronic
902502952 1:16922627-16922649 GAGAGGGTCTTCAGGGGACATGG - Intronic
902761547 1:18583993-18584015 TGGAGGCTCTTGAAGGGAAGGGG - Intergenic
906006029 1:42471257-42471279 TGGAGGATGTTAAAAGGAAAAGG - Intronic
906070374 1:43012013-43012035 ATGAGGGTCTTCAAGGGGCAAGG - Intergenic
906258273 1:44367215-44367237 TGGAGGATCGTCCAGGGCCTGGG + Intergenic
907245979 1:53109479-53109501 TGGAGGGTCATCCAGGGACATGG + Intronic
907694015 1:56702459-56702481 TGAAGGATTTTAAAGAGACAGGG - Intronic
907809267 1:57852170-57852192 ATGAGGATCTTCAGGGGAAAAGG - Intronic
912430540 1:109626314-109626336 TGCAGGCTCTACAAGGAACAGGG + Exonic
915346636 1:155200859-155200881 GAGAGGAGCTTCAAGGGGCAGGG + Intronic
916282247 1:163064577-163064599 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
918217629 1:182406687-182406709 TGGAGGAGCTCCAAGGTATAAGG + Intergenic
920062098 1:203233983-203234005 AGGAGGCTCTTCTGGGGACAGGG - Intronic
920229014 1:204458099-204458121 AGGAGGAGCTTCAAGGGGAACGG - Intronic
920314394 1:205067086-205067108 TGCAGGATCTGCAAGGCACCAGG - Exonic
920335535 1:205242746-205242768 TGTGGGAGCTTCAAGGGAGAGGG + Intronic
920353437 1:205352813-205352835 AGGAGGATGCTCAAGGGCCAAGG - Intronic
920817666 1:209350034-209350056 TGAATTATCTTCAAAGGACACGG - Intergenic
923233891 1:232013788-232013810 TGGAGGGCCTTCAAGGGAGAAGG + Intronic
923569408 1:235100672-235100694 TGGAGGATCTGCCAGAAACAAGG - Intergenic
1063854553 10:10234069-10234091 TGGAGTATATTTAAAGGACAGGG - Intergenic
1064295672 10:14076962-14076984 TGGAGGGTTCTCAAGGGAGAGGG + Intronic
1067953276 10:50764977-50764999 TAGAGAAGCTTCAAGGGATAAGG + Intronic
1069425495 10:68285190-68285212 TGGAGGATCTTTAAGGGTGAAGG + Intronic
1069662973 10:70135926-70135948 TGGAGGAGCTCCAAGGTACTGGG + Intergenic
1070284201 10:75071630-75071652 TGAAGGATCTTCATGGGCAAAGG - Intergenic
1071033693 10:81216379-81216401 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1072068238 10:91890976-91890998 TGGAGGATGTTCAAGGTCTATGG + Intergenic
1072318652 10:94227606-94227628 TGCAGCATCTTTGAGGGACAGGG - Intronic
1072429029 10:95355245-95355267 TGCAGGACCTTATAGGGACAAGG + Intronic
1073077662 10:100834828-100834850 AGGAAGGTCTTGAAGGGACAGGG + Intergenic
1074099799 10:110345805-110345827 TGGAGGAACCACAAGGAACATGG + Intergenic
1074800119 10:116991379-116991401 TGCAGGCTCTACAAGGAACATGG + Intronic
1075317953 10:121467226-121467248 TGGGGGAGCTTCAAGGGAGGTGG - Intergenic
1079589644 11:22166842-22166864 TGGGTGATCTTCATGAGACATGG - Intergenic
1081339990 11:41916682-41916704 TGGAGTATCTGAAAGGGACAGGG - Intergenic
1083780056 11:64913125-64913147 TGGAGGCTCTTCCTGGGAGACGG + Exonic
1085003539 11:73062813-73062835 TGGTGTATCTGAAAGGGACAAGG + Intronic
1085200085 11:74696677-74696699 AGGAGGAACTGCAAGGGCCAGGG + Intronic
1085346420 11:75770983-75771005 GGGAGTATCTTCAAGGACCAAGG - Intronic
1085450272 11:76627756-76627778 TGGTGGCTCTTCCAGGAACATGG - Intergenic
1086427082 11:86695833-86695855 TGGAGGAGCTCCAAGGTAGAAGG + Intergenic
1087903011 11:103663830-103663852 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1088095576 11:106096825-106096847 TGAAGGATCTTCAGGTGTCATGG - Exonic
1090099979 11:123784167-123784189 AGGAGGGTCTTCAAGAGAGAAGG - Intergenic
1091562459 12:1625504-1625526 TGGATGATTTCCATGGGACAGGG - Intronic
1092970105 12:13685521-13685543 GGGAGGATCTTCCAGGGTCAAGG + Intronic
1096027473 12:48379511-48379533 TGGAGTATCTTGAGGGGAAAAGG - Intergenic
1096100572 12:48968462-48968484 TGGAGGAAAGTCATGGGACAAGG + Intronic
1096592688 12:52671847-52671869 ACGAGGATCTTCAAGGCAGAGGG - Intergenic
1096678834 12:53241705-53241727 TGGAGGATTTTCAGGGGAGAGGG + Intergenic
1097837320 12:64286314-64286336 TGGATGATCTTCAAGGTTAATGG - Intronic
1099465097 12:82974913-82974935 AAGAGGATCTTCAAGGGAGACGG + Intronic
1099612265 12:84889000-84889022 ATGAGGATCTTCAAGGGAGAAGG - Intronic
1099971579 12:89505779-89505801 TGGAGAAGCTACAAGGGGCAAGG + Intronic
1101093221 12:101309066-101309088 TGATGTATCTTCAAGGGTCATGG - Intronic
1101228306 12:102712329-102712351 TGTAGGAATTTAAAGGGACAGGG - Intergenic
1104612031 12:130236698-130236720 TGGAGGAACCCCAAAGGACAAGG + Intergenic
1105812926 13:24010603-24010625 TGGAGGAGCTTCCAGGCACGAGG - Intronic
1110173005 13:72524599-72524621 TAGAGCATCTTCAGGGGACATGG + Intergenic
1111425244 13:88071695-88071717 ATGAGGATCTTTAAGGGAGAAGG - Intergenic
1111827404 13:93284991-93285013 AGGAGAAGCTTCAAGGCACAGGG + Intronic
1113984776 13:114304855-114304877 AGGAGGATCTGCAAGGCAGAAGG + Exonic
1117210926 14:53498873-53498895 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1120242665 14:81967215-81967237 ATGAGGATCTTCAAGGGAGAAGG - Intergenic
1120631700 14:86899600-86899622 TGCAAAATCTTCAAGGGAAAGGG - Intergenic
1120985638 14:90332061-90332083 AGGAGGGTCGTCAAGGGACTGGG + Exonic
1121788524 14:96681171-96681193 TGGAAGTTGTTCAAGAGACAGGG - Intergenic
1122170857 14:99873846-99873868 TGGAGGGTCCACAAGGGACCAGG - Intronic
1123753929 15:23381652-23381674 TGGAGAAACTTCAAGGGGTAAGG - Intergenic
1124397458 15:29316278-29316300 TGAAGGATAATCAAGAGACATGG + Intronic
1124992719 15:34691892-34691914 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1127897681 15:63316800-63316822 TGGATGATCTGGAAGGGAGACGG - Intergenic
1128239481 15:66092040-66092062 TGGAAGAAATTCCAGGGACAAGG + Intronic
1128285069 15:66429884-66429906 CTGAGGAGCTTCAATGGACAGGG - Intronic
1128578299 15:68791067-68791089 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1130833356 15:87625698-87625720 TGGAGAATATTCAAGGCAGAAGG - Intergenic
1133559210 16:6934746-6934768 TGGAGGATCTCAGAGGGAAAGGG + Intronic
1133646528 16:7769792-7769814 AGGAGGGTTTTCAAGGGAGAAGG + Intergenic
1133746183 16:8688397-8688419 TGGAGGACCTCCCAGGGCCAGGG + Intronic
1135606181 16:23826776-23826798 TGGAGGCTCTTCAAGGGAAGAGG + Intergenic
1136065263 16:27754285-27754307 AGGAGGACCTTCCAGGGACAGGG + Intronic
1137814197 16:51382834-51382856 TGGAAGATTTTCATGGGTCAGGG + Intergenic
1138510160 16:57504047-57504069 TGGAGGCTCAACAAGGGACTGGG - Intergenic
1138615205 16:58159778-58159800 TGGATAATCTTCAAGGACCATGG - Intronic
1140335133 16:74097942-74097964 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1141554017 16:84825169-84825191 AGGGGGATATTCAAAGGACAGGG + Intronic
1143628666 17:8124837-8124859 AGGAGGATCTTCAAGGCAGAGGG + Intergenic
1143792385 17:9307912-9307934 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1144613362 17:16745671-16745693 AGGAGGATCTGCAAGGCAGAAGG - Intronic
1145133026 17:20375747-20375769 AGGAGGATCTGCAAGGCAGAAGG - Intergenic
1146585851 17:34080929-34080951 GGGAGGATCTTCAATGAGCAGGG - Intronic
1146592175 17:34136951-34136973 GTGAGGATCTTCCAGGGCCAGGG - Intronic
1147248234 17:39136222-39136244 AGGTGGAACTTCAGGGGACATGG - Intronic
1150248819 17:63694888-63694910 GGGAGGAGCTACAAGGGAAAGGG - Exonic
1150701335 17:67449143-67449165 GTGACGATCTTCAAGTGACAGGG - Intronic
1153333319 18:3896860-3896882 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1155041821 18:22071188-22071210 TGGAGAATGTTCAAGGCAGAAGG - Intergenic
1155237871 18:23839799-23839821 TGGAGGAGTTTCATGGGCCAAGG - Exonic
1155611819 18:27674658-27674680 GGGAAGAGCTTCAAGGCACAAGG - Intergenic
1157015203 18:43703891-43703913 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1160003693 18:75052469-75052491 TGGAGGATCTTCAAGGGACATGG - Intronic
1161720788 19:5901305-5901327 TCGAGGGTCTTCAAGAGAAAGGG - Intronic
1163533871 19:17866098-17866120 TGGAGGGGCTCCAAGGCACAGGG - Intergenic
1163931922 19:20402986-20403008 TGGAGGACTTTCAAAGGCCAAGG + Intergenic
925079732 2:1054308-1054330 TGGAGCATCTTCACGGCACCAGG + Intronic
928108343 2:28487493-28487515 AGGAGGAGCATCCAGGGACACGG - Intronic
929460189 2:42097651-42097673 AGGAGGACCTTCCAGGGAAAAGG - Intergenic
930122164 2:47769147-47769169 AGGAGGATCTTCAAGGGAGAAGG + Intronic
930127653 2:47815324-47815346 ATGAGGATCTTCCAGGGAGAAGG + Intronic
932101907 2:68908857-68908879 TGAAGGTTCTCCAAGGGGCAGGG - Intergenic
932827653 2:74956609-74956631 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
935050015 2:99517567-99517589 TTGAGGTTCTTCATGGGACCCGG + Intergenic
937707277 2:124935649-124935671 CGGAGGACCTTCAAGGGGAAGGG + Intergenic
939643842 2:144672184-144672206 TGGAGGAGCAACAAGGGCCATGG - Intergenic
1171060102 20:21948536-21948558 TTGAGGAAATTCAAGGTACAAGG - Intergenic
1171447609 20:25215959-25215981 TGGATGTTCTGCAGGGGACAGGG - Intronic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1174037596 20:47677843-47677865 GGGAGGAGCCTCAATGGACACGG + Intronic
1174562215 20:51439447-51439469 TGGAGGAGCTGCAAGGCACAGGG - Intronic
1178139238 21:29663422-29663444 TGGATGATGTTCCAGGGACTAGG + Intronic
1178293031 21:31386105-31386127 TGGAGGGGCTGCCAGGGACAGGG + Intronic
1178496519 21:33090741-33090763 TGGAGGACATGCAAGGGAGAGGG - Intergenic
1179253861 21:39698285-39698307 TGGAGGAACTTGCAGGGACGAGG + Intergenic
1181451672 22:23026793-23026815 TGGAGGATCCAGAAGGGAGATGG + Intergenic
1182031513 22:27162874-27162896 TGGAGGATGTTCTAGGCAGAGGG + Intergenic
1182857473 22:33530657-33530679 TGCATGATCCTCATGGGACATGG - Intronic
1182901582 22:33902903-33902925 TGGTGGATCTTCTAAGGTCAGGG + Intronic
1183730296 22:39614714-39614736 GGGAGGCTCTTCAAGGAATAAGG + Intronic
1184262535 22:43327445-43327467 TAGAGGATGGTCAAGGGGCATGG + Intronic
949474361 3:4429594-4429616 AAGAGCATCCTCAAGGGACAGGG + Intronic
950921671 3:16700961-16700983 TGGAGTGGCTTCAAGGGAAAAGG + Intergenic
951755363 3:26085490-26085512 ATGAGGATCTTCATGGGAGAAGG - Intergenic
952509374 3:34038024-34038046 TGGAGGGGCATCAAGGGAGACGG + Intergenic
955376148 3:58398708-58398730 TTGAGTATCTCCAAGGCACAGGG - Intronic
955412005 3:58661825-58661847 AGGAGCATCTCCAAGGGAGAGGG - Intronic
955651046 3:61194151-61194173 ATGAGGATCTTCAAAGGAGAAGG + Intronic
956408387 3:68952398-68952420 AGGAGGTTCTGCAAAGGACAAGG + Intergenic
956691848 3:71885774-71885796 TGGAGAAGCTTCAAGGAAGAAGG - Intergenic
956747367 3:72320437-72320459 TGGAGGACCTTGAGGGGAAAAGG + Intergenic
960425496 3:117502059-117502081 ATGAGGGTCTTCAAGGGAAAAGG - Intergenic
961413302 3:126739055-126739077 TGGAGGAGGTATAAGGGACAAGG - Intronic
961624947 3:128255270-128255292 TGAAGGATAGTCAAGGGCCATGG + Intronic
962781917 3:138727143-138727165 TGGAAGATGTTCAAGTGCCAGGG + Intronic
964227928 3:154428845-154428867 TGGAGCATCCTCTGGGGACAGGG + Exonic
966626823 3:182025886-182025908 TGGAGGATCATCAATAGACAAGG - Intergenic
970829178 4:20315554-20315576 TGGAGGTTGTTGAAGGGAGAAGG + Intronic
977411750 4:96674958-96674980 TGGAGGATCTTCAGAGGAGAAGG - Intergenic
977918922 4:102622973-102622995 GGTAGGATCTTAAAGGGCCAGGG - Intergenic
978735240 4:112077208-112077230 TGGAGCATGTGCCAGGGACATGG - Intergenic
979489328 4:121307259-121307281 TGGAGGATCTCAAAAAGACATGG + Intergenic
981627547 4:146776526-146776548 TGGAGGATTTTAGAGGGCCAAGG + Intronic
981805374 4:148709307-148709329 GGGAGGATATGCAGGGGACAAGG - Intergenic
987222760 5:15807342-15807364 TGGAGGATCTCTAAGAGGCAGGG - Intronic
987775057 5:22354601-22354623 TGGAGGATCTGCTGGGGAGAAGG + Intronic
989676543 5:43980483-43980505 TGGAGGACCTGAAAGAGACAGGG - Intergenic
991993306 5:72362714-72362736 TTGAGAATCTACAAAGGACAAGG + Intergenic
995083926 5:108086133-108086155 ATGAGGATCTTCAAGGGAGAAGG - Intronic
995083941 5:108086223-108086245 ATGAGGATCTTCAAGGGAGAAGG - Intronic
995264010 5:110137686-110137708 TGGAGTACCTAAAAGGGACACGG - Intergenic
996119494 5:119655039-119655061 TGGGGGATATTCAAGGATCATGG + Intergenic
998486421 5:142506419-142506441 AGGAGGATGTTGAAGGGTCAAGG + Intergenic
998647967 5:144084928-144084950 TGGTAGATCATCAAGGGAGAGGG - Intergenic
999015586 5:148100736-148100758 TTGACAATCTTCAAAGGACATGG - Intronic
999227135 5:150035027-150035049 TGTAAGCTCTTCAAGGGAAAGGG - Intronic
999339705 5:150759352-150759374 TGGAAGGTCTCAAAGGGACAGGG + Intergenic
999476481 5:151904247-151904269 TGGAGGATCTTGAAGGTACAGGG - Intronic
1000800145 5:165715528-165715550 TTGAGGATCTTCAGGGAGCAGGG + Intergenic
1001761244 5:174210108-174210130 AGGTGGATCTTGAAGGGAGAAGG - Intronic
1007075729 6:39065023-39065045 TGGGGGATCTCCAAAGGCCAAGG + Intronic
1008109439 6:47477406-47477428 TCGAGGACCTTAAAGGGAAAAGG - Intergenic
1008680781 6:53869659-53869681 TGGAGAAACTGCAAGTGACAAGG + Intronic
1009397942 6:63223342-63223364 TGGAGGATCCTGAAAGGACTTGG - Intergenic
1010250061 6:73697829-73697851 TGGAGTTTCTTCATGGGAGAAGG + Intronic
1010465264 6:76160629-76160651 GGGAAGATCTTCAAGGCAGAGGG + Intergenic
1010972044 6:82273349-82273371 ATGAGGATCTTCAAGGAAGAAGG + Intergenic
1011101938 6:83731852-83731874 ATGAAGATCTTCAAGGGAAAAGG + Intergenic
1014114018 6:117652522-117652544 ATGAGGATCTTGAAAGGACAGGG + Intergenic
1014717968 6:124887793-124887815 TGGGGGATCCACAAGGGAGATGG - Intergenic
1017052306 6:150405076-150405098 TGCAAGATCTGAAAGGGACATGG + Intronic
1019176247 6:170160765-170160787 GGGCGGCTCTTCCAGGGACATGG + Intergenic
1019571931 7:1716882-1716904 AGGAGGATCTGCAGGGGCCAGGG + Intronic
1021441690 7:20684800-20684822 TGGAAGAGTTTCCAGGGACACGG - Intronic
1021569187 7:22047138-22047160 TGTAGGCTCTGCAAGGCACAGGG + Intergenic
1022463387 7:30633507-30633529 TGAAGTAACTTCAAGGGACATGG + Intronic
1022563403 7:31373179-31373201 TGGAGCATCAGCAAGGGGCAGGG - Intergenic
1022681109 7:32547061-32547083 TGGAGGATTTTTATGGGAGAGGG + Intronic
1026869157 7:73840345-73840367 TGGAGGATCAGCAAGGGAAAGGG + Intronic
1027170987 7:75872325-75872347 TGGAGAAGCTTCAGGGGTCATGG - Intronic
1029701771 7:102251590-102251612 TAGAGGAGCTTAAGGGGACACGG + Exonic
1037425314 8:18749189-18749211 TGGAGTACATTCAAGGGATATGG + Intronic
1038086836 8:24207275-24207297 AGGAAGACCTTCAAGTGACATGG + Intergenic
1038259752 8:25982445-25982467 TGGTGGAGGTTCAAGGGGCAAGG - Intronic
1038438583 8:27555973-27555995 ACGAGGGTCTTCAAGGGAGAGGG + Intergenic
1040012818 8:42676453-42676475 TAGAGGATCTCCTTGGGACATGG + Intergenic
1042612480 8:70614191-70614213 TGGAGGATGTGCAAGGGTGAGGG + Intronic
1042630444 8:70809815-70809837 TGGTGTATCTTAAAGTGACAGGG + Intergenic
1044038490 8:87336312-87336334 TGGAGTACCTGAAAGGGACAGGG - Intronic
1045288663 8:100813177-100813199 ATGAGGGTCTTCAAGGGAAAAGG - Intergenic
1046295749 8:112217741-112217763 TAAATGATCTCCAAGGGACAGGG + Intergenic
1047301012 8:123613413-123613435 TTGAGGATCTTCAAGGGAGAAGG + Intergenic
1048506833 8:135029419-135029441 AGGAGGATCCACATGGGACAAGG - Intergenic
1049159608 8:141088957-141088979 TGGAGTGTCTTCAAGAGAGAAGG - Intergenic
1049495180 8:142926863-142926885 TGGAGGATTCTCAAGGGACCAGG - Intergenic
1051130975 9:13860636-13860658 TGAAGGAGCTTCAATGTACATGG + Intergenic
1052173434 9:25428448-25428470 TGGAGGATTTTAGGGGGACATGG - Intergenic
1055791321 9:79926127-79926149 TTGAGGGCCTTCAGGGGACAAGG + Intergenic
1056010721 9:82327077-82327099 TGGAGTACCTACAAGAGACAGGG - Intergenic
1057815629 9:98291955-98291977 TGGAGGAGCAGCAAGGGAAAAGG + Intronic
1059864450 9:118499324-118499346 AGGAAGATCTACAAGGGAAATGG - Intergenic
1060267991 9:122123291-122123313 CGGAGGATCCTCAAGGGCAAAGG + Intergenic
1060731410 9:126039372-126039394 GGGAGAATCCTCAAGAGACATGG - Intergenic
1061471539 9:130830549-130830571 TGGAGGTTTTCCAAGGGACCAGG - Intronic
1186235794 X:7508037-7508059 TGGAGGAACTTCATGGAATATGG + Intergenic
1186457433 X:9720962-9720984 AGGAGGAGCTTCAATGGACTGGG - Intergenic
1187261868 X:17692380-17692402 TGGAGGAGCTGCAATGGAAAGGG - Exonic
1188835490 X:34948950-34948972 TGGAAGATTTTCAGGGGTCAAGG - Intergenic
1189208180 X:39259756-39259778 TGGAGGGGGTTCAAGGGTCATGG - Intergenic
1189861143 X:45273691-45273713 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1195144632 X:102000632-102000654 TGGAAGATTTCCAAGGGCCAAGG - Intergenic
1196203275 X:112910264-112910286 TGGAGTATGTCAAAGGGACAAGG - Intergenic
1199000611 X:142632281-142632303 TGGAAGATTTTCATGGGCCAAGG + Intergenic
1201601877 Y:15738513-15738535 TGGAGGAACTTCATGGAATATGG + Intergenic