ID: 1160005163

View in Genome Browser
Species Human (GRCh38)
Location 18:75063858-75063880
Sequence CACGGCGGCCGGGCTCTCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160005163_1160005172 -4 Left 1160005163 18:75063858-75063880 CCCAGGAGAGCCCGGCCGCCGTG 0: 1
1: 0
2: 2
3: 14
4: 254
Right 1160005172 18:75063877-75063899 CGTGGAGGTGCTCACCCAGGTGG 0: 1
1: 0
2: 0
3: 21
4: 160
1160005163_1160005170 -7 Left 1160005163 18:75063858-75063880 CCCAGGAGAGCCCGGCCGCCGTG 0: 1
1: 0
2: 2
3: 14
4: 254
Right 1160005170 18:75063874-75063896 CGCCGTGGAGGTGCTCACCCAGG 0: 1
1: 0
2: 0
3: 3
4: 104
1160005163_1160005175 17 Left 1160005163 18:75063858-75063880 CCCAGGAGAGCCCGGCCGCCGTG 0: 1
1: 0
2: 2
3: 14
4: 254
Right 1160005175 18:75063898-75063920 GGTCCATCCCTCAGCAGCCATGG 0: 1
1: 0
2: 4
3: 15
4: 206
1160005163_1160005179 26 Left 1160005163 18:75063858-75063880 CCCAGGAGAGCCCGGCCGCCGTG 0: 1
1: 0
2: 2
3: 14
4: 254
Right 1160005179 18:75063907-75063929 CTCAGCAGCCATGGCCTCTCAGG 0: 1
1: 0
2: 5
3: 62
4: 845

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160005163 Original CRISPR CACGGCGGCCGGGCTCTCCT GGG (reversed) Exonic