ID: 1160011293

View in Genome Browser
Species Human (GRCh38)
Location 18:75108731-75108753
Sequence GGCCCTCGGTGGAGGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160011293_1160011301 2 Left 1160011293 18:75108731-75108753 CCTCCCTGCCTCCACCGAGGGCC No data
Right 1160011301 18:75108756-75108778 GCATTTCCATGTCTTCTCTCTGG No data
1160011293_1160011303 23 Left 1160011293 18:75108731-75108753 CCTCCCTGCCTCCACCGAGGGCC No data
Right 1160011303 18:75108777-75108799 GGCTCCCAGCTCTGCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160011293 Original CRISPR GGCCCTCGGTGGAGGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr