ID: 1160014354

View in Genome Browser
Species Human (GRCh38)
Location 18:75129057-75129079
Sequence ACGGCAACACACCTCCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160014354_1160014362 23 Left 1160014354 18:75129057-75129079 CCATGGTGGAGGTGTGTTGCCGT No data
Right 1160014362 18:75129103-75129125 GCAGTTCCAGCTCTGGCACTGGG No data
1160014354_1160014361 22 Left 1160014354 18:75129057-75129079 CCATGGTGGAGGTGTGTTGCCGT No data
Right 1160014361 18:75129102-75129124 AGCAGTTCCAGCTCTGGCACTGG No data
1160014354_1160014360 16 Left 1160014354 18:75129057-75129079 CCATGGTGGAGGTGTGTTGCCGT No data
Right 1160014360 18:75129096-75129118 TTTCTCAGCAGTTCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160014354 Original CRISPR ACGGCAACACACCTCCACCA TGG (reversed) Intergenic
No off target data available for this crispr