ID: 1160014948

View in Genome Browser
Species Human (GRCh38)
Location 18:75133421-75133443
Sequence CTGGAACTTCCCCAAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160014948_1160014952 10 Left 1160014948 18:75133421-75133443 CCCTCTCCTTGGGGAAGTTCCAG No data
Right 1160014952 18:75133454-75133476 CTCAATTGTCTAGAAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160014948 Original CRISPR CTGGAACTTCCCCAAGGAGA GGG (reversed) Intergenic
No off target data available for this crispr