ID: 1160015849

View in Genome Browser
Species Human (GRCh38)
Location 18:75139812-75139834
Sequence AGGGAGTGAAGGCCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160015849_1160015853 -4 Left 1160015849 18:75139812-75139834 CCTTCCTCAGGCCTTCACTCCCT No data
Right 1160015853 18:75139831-75139853 CCCTCCTAGTCCAGAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160015849 Original CRISPR AGGGAGTGAAGGCCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr