ID: 1160016073 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:75141704-75141726 |
| Sequence | GTGGCCTGGAGCACTGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1160016073_1160016081 | 17 | Left | 1160016073 | 18:75141704-75141726 | CCTTCCTCAGTGCTCCAGGCCAC | No data | ||
| Right | 1160016081 | 18:75141744-75141766 | ACTGCTGTGAGCCTCCCTCCTGG | No data | ||||
| 1160016073_1160016076 | -7 | Left | 1160016073 | 18:75141704-75141726 | CCTTCCTCAGTGCTCCAGGCCAC | No data | ||
| Right | 1160016076 | 18:75141720-75141742 | AGGCCACCTGCCTTGCACCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1160016073 | Original CRISPR | GTGGCCTGGAGCACTGAGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||