ID: 1160016073

View in Genome Browser
Species Human (GRCh38)
Location 18:75141704-75141726
Sequence GTGGCCTGGAGCACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160016073_1160016081 17 Left 1160016073 18:75141704-75141726 CCTTCCTCAGTGCTCCAGGCCAC No data
Right 1160016081 18:75141744-75141766 ACTGCTGTGAGCCTCCCTCCTGG No data
1160016073_1160016076 -7 Left 1160016073 18:75141704-75141726 CCTTCCTCAGTGCTCCAGGCCAC No data
Right 1160016076 18:75141720-75141742 AGGCCACCTGCCTTGCACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160016073 Original CRISPR GTGGCCTGGAGCACTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr