ID: 1160016318

View in Genome Browser
Species Human (GRCh38)
Location 18:75143455-75143477
Sequence GGATCCAACAAGTGTCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160016313_1160016318 -1 Left 1160016313 18:75143433-75143455 CCTGGCAATGACCAAGAAATTGG No data
Right 1160016318 18:75143455-75143477 GGATCCAACAAGTGTCTGAAGGG No data
1160016311_1160016318 19 Left 1160016311 18:75143413-75143435 CCAACGGTTTACTCTCTGGTCCT No data
Right 1160016318 18:75143455-75143477 GGATCCAACAAGTGTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160016318 Original CRISPR GGATCCAACAAGTGTCTGAA GGG Intergenic
No off target data available for this crispr