ID: 1160018745

View in Genome Browser
Species Human (GRCh38)
Location 18:75164332-75164354
Sequence TGCTGTTTCTGGAGCGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160018741_1160018745 23 Left 1160018741 18:75164286-75164308 CCTGTTCTTTCAAAGAGTTGGCT No data
Right 1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160018745 Original CRISPR TGCTGTTTCTGGAGCGCAGA GGG Intergenic
No off target data available for this crispr