ID: 1160019361

View in Genome Browser
Species Human (GRCh38)
Location 18:75168178-75168200
Sequence CCGTGTTGCCAGGAAACTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160019353_1160019361 26 Left 1160019353 18:75168129-75168151 CCCTTCTCGGAGCCGCGCACTTG No data
Right 1160019361 18:75168178-75168200 CCGTGTTGCCAGGAAACTGCGGG No data
1160019352_1160019361 29 Left 1160019352 18:75168126-75168148 CCGCCCTTCTCGGAGCCGCGCAC No data
Right 1160019361 18:75168178-75168200 CCGTGTTGCCAGGAAACTGCGGG No data
1160019351_1160019361 30 Left 1160019351 18:75168125-75168147 CCCGCCCTTCTCGGAGCCGCGCA No data
Right 1160019361 18:75168178-75168200 CCGTGTTGCCAGGAAACTGCGGG No data
1160019354_1160019361 25 Left 1160019354 18:75168130-75168152 CCTTCTCGGAGCCGCGCACTTGG No data
Right 1160019361 18:75168178-75168200 CCGTGTTGCCAGGAAACTGCGGG No data
1160019356_1160019361 14 Left 1160019356 18:75168141-75168163 CCGCGCACTTGGTAACTTGCGTG No data
Right 1160019361 18:75168178-75168200 CCGTGTTGCCAGGAAACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160019361 Original CRISPR CCGTGTTGCCAGGAAACTGC GGG Intergenic
No off target data available for this crispr