ID: 1160020224

View in Genome Browser
Species Human (GRCh38)
Location 18:75174629-75174651
Sequence GGTTTAATCTGACAATGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160020215_1160020224 20 Left 1160020215 18:75174586-75174608 CCTCTGGATATTCTTAAACATAC No data
Right 1160020224 18:75174629-75174651 GGTTTAATCTGACAATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160020224 Original CRISPR GGTTTAATCTGACAATGCTC AGG Intergenic
No off target data available for this crispr