ID: 1160024097

View in Genome Browser
Species Human (GRCh38)
Location 18:75204702-75204724
Sequence TCTCAACTCCACCGCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160024097_1160024110 24 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024110 18:75204749-75204771 TCGGCCTCTCCGGGTCGGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 90
1160024097_1160024112 26 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024112 18:75204751-75204773 GGCCTCTCCGGGTCGGGCGGGGG 0: 1
1: 0
2: 1
3: 16
4: 186
1160024097_1160024101 5 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024101 18:75204730-75204752 CAGGCCTGCGACCGTGACCTCGG 0: 1
1: 0
2: 2
3: 7
4: 81
1160024097_1160024111 25 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024111 18:75204750-75204772 CGGCCTCTCCGGGTCGGGCGGGG 0: 1
1: 0
2: 2
3: 15
4: 140
1160024097_1160024107 20 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024107 18:75204745-75204767 GACCTCGGCCTCTCCGGGTCGGG 0: 1
1: 0
2: 0
3: 14
4: 292
1160024097_1160024109 23 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024109 18:75204748-75204770 CTCGGCCTCTCCGGGTCGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 121
1160024097_1160024106 19 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024106 18:75204744-75204766 TGACCTCGGCCTCTCCGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 75
1160024097_1160024104 15 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024104 18:75204740-75204762 ACCGTGACCTCGGCCTCTCCGGG 0: 1
1: 0
2: 1
3: 12
4: 180
1160024097_1160024103 14 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024103 18:75204739-75204761 GACCGTGACCTCGGCCTCTCCGG 0: 1
1: 0
2: 2
3: 53
4: 1138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160024097 Original CRISPR TCTCAACTCCACCGCGGCGC CGG (reversed) Intronic
900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG + Intronic
902819993 1:18937927-18937949 TCTCAACTCCAACCCAGCGGGGG + Intronic
908380551 1:63593614-63593636 TATCATCTCCACCGTGGAGCCGG + Intronic
922101603 1:222481867-222481889 TCTCAACACCACCACGACCCTGG + Intergenic
922262684 1:223956983-223957005 TCTCAACACCACCACGACCCTGG + Intergenic
923776701 1:236985090-236985112 TCTCACCTCCACTGAGGAGCAGG + Intergenic
924344523 1:243061984-243062006 TCTCAACACCACCACGACCCTGG + Intergenic
1064443101 10:15371047-15371069 GCTCATCTCCGCCGCGGGGCCGG + Exonic
1066731810 10:38443088-38443110 TCTCAACACCACCACGACCCTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1088756158 11:112887048-112887070 TCTCAACTTCACCAAGGCTCAGG - Intergenic
1090384407 11:126348227-126348249 TCTCGACTCCCCCGAGGGGCTGG + Intergenic
1102315751 12:111885976-111885998 GCTCAATTCCACCGAGGCCCTGG + Exonic
1104424032 12:128659954-128659976 TCTCAGCTCCACCGCGCTGCTGG + Intronic
1106869533 13:34003611-34003633 GCTCCACTCCACCGAGGCGAGGG + Intergenic
1112507194 13:99982127-99982149 TCACCACTCCGCCGCGGCGGCGG + Exonic
1123006466 14:105326223-105326245 TCTCAACTCCACTGCTGCGGGGG - Intronic
1123215430 14:106804929-106804951 TCTCAACTCCATCGTGACGGTGG - Intergenic
1127988832 15:64096156-64096178 ACTCACGACCACCGCGGCGCCGG - Exonic
1145012886 17:19379581-19379603 TCACAACTCCCCTGCGGGGCAGG - Intronic
1152789915 17:82273370-82273392 TCTCAGCTCCATGGCGGCGGCGG + Exonic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
926169079 2:10539731-10539753 TCCCAGCTCCACCGGGACGCAGG + Intergenic
940301011 2:152176223-152176245 TCTCAAAGCCACCTCCGCGCCGG - Intergenic
943470796 2:188292018-188292040 TCTCTACGCCAACACGGCGCTGG - Intronic
1168830716 20:844004-844026 TCTGGACTCCACTGGGGCGCGGG + Intronic
1172022438 20:31924143-31924165 TCTCACCTCCACCCCGGGCCTGG + Intronic
966594346 3:181712426-181712448 CGGCAACTCCACCGCGGCGGCGG + Exonic
968124309 3:196147135-196147157 TCTGAACCCCACTGGGGCGCAGG - Intergenic
979258196 4:118625715-118625737 TCTCAACACCACCACGACCCTGG - Intergenic
979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG + Intergenic
985783305 5:1881894-1881916 GCTCAACTCGGCCGCGGCGCTGG - Exonic
992038922 5:72809142-72809164 TCTCTACTCCACCAGGGCCCTGG - Intergenic
999314247 5:150574049-150574071 TTTCAGCTCCTCCGCGGCGCTGG - Intergenic
1003948104 6:11093773-11093795 GCTCGCCTCCTCCGCGGCGCGGG - Intergenic
1022620759 7:31982173-31982195 TCTCAACTGCACCCCTGAGCTGG + Intronic
1023400180 7:39787009-39787031 TCTCAACACCACCATGGCCCTGG - Intergenic
1024073109 7:45802760-45802782 TCTCAACACCACCACGACCCTGG - Intergenic
1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG + Intergenic
1025054370 7:55753077-55753099 TCTCAACACCACCATGGCCCTGG + Intergenic
1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG + Intergenic
1035301834 7:157902342-157902364 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301850 7:157902410-157902432 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301861 7:157902444-157902466 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301888 7:157902546-157902568 TCTCCAGACCACCGCGGGGCTGG - Intronic
1035678923 8:1473391-1473413 TCTCAGATCCACTGCGGGGCTGG + Intergenic
1035761081 8:2069343-2069365 TCTCACCACCACCGCCGCGTTGG - Exonic
1049549117 8:143248464-143248486 ACTCCACTCCACGGCGGGGCGGG - Intronic
1053480640 9:38414150-38414172 TCACAACGTCACCGGGGCGCAGG - Exonic
1056251562 9:84753626-84753648 TCTCAACTGCACCCAGGCCCAGG + Intronic
1058412317 9:104747643-104747665 GGTCAGCTCCACCCCGGCGCGGG - Intergenic
1058413776 9:104764091-104764113 GGTCAGCTCCACCCCGGCGCGGG - Intergenic
1061472037 9:130834948-130834970 GCGCAACTCCACCGCGGCCTGGG - Intronic
1190054606 X:47174408-47174430 TCTCAGCCTCACCGCAGCGCAGG - Intronic
1195078442 X:101348946-101348968 TCTCAACGGCACCTCGGCTCTGG - Exonic
1198217885 X:134573425-134573447 TCTCAACTCCACGGCAGCCACGG + Intronic
1201150294 Y:11091912-11091934 TCTCATGTCCACCTGGGCGCTGG - Intergenic