ID: 1160024107

View in Genome Browser
Species Human (GRCh38)
Location 18:75204745-75204767
Sequence GACCTCGGCCTCTCCGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160024097_1160024107 20 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024107 18:75204745-75204767 GACCTCGGCCTCTCCGGGTCGGG 0: 1
1: 0
2: 0
3: 14
4: 292
1160024100_1160024107 -5 Left 1160024100 18:75204727-75204749 CCTCAGGCCTGCGACCGTGACCT 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1160024107 18:75204745-75204767 GACCTCGGCCTCTCCGGGTCGGG 0: 1
1: 0
2: 0
3: 14
4: 292
1160024098_1160024107 14 Left 1160024098 18:75204708-75204730 CCGCGGTGGAGTTGAGATTCCTC 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1160024107 18:75204745-75204767 GACCTCGGCCTCTCCGGGTCGGG 0: 1
1: 0
2: 0
3: 14
4: 292
1160024096_1160024107 21 Left 1160024096 18:75204701-75204723 CCCGGCGCCGCGGTGGAGTTGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1160024107 18:75204745-75204767 GACCTCGGCCTCTCCGGGTCGGG 0: 1
1: 0
2: 0
3: 14
4: 292
1160024094_1160024107 30 Left 1160024094 18:75204692-75204714 CCGCGCAGGCCCGGCGCCGCGGT 0: 1
1: 0
2: 0
3: 15
4: 180
Right 1160024107 18:75204745-75204767 GACCTCGGCCTCTCCGGGTCGGG 0: 1
1: 0
2: 0
3: 14
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160024107 Original CRISPR GACCTCGGCCTCTCCGGGTC GGG Intronic
900564497 1:3325697-3325719 GTCCCCAGCCTCTCCAGGTCTGG + Intronic
901173524 1:7281949-7281971 GACCTCGGCCACCCAGGGCCAGG + Intronic
901822992 1:11842174-11842196 GACCCCGGCCTCTCGAGGGCTGG + Exonic
902429223 1:16349778-16349800 AACCTCCACCTCTCCGGTTCAGG - Intronic
902877699 1:19350694-19350716 AACCTCGGCCTCCCAGGTTCAGG + Intronic
902941552 1:19803506-19803528 AACCTCCGCCTCTCAGGTTCAGG - Intergenic
903007300 1:20307228-20307250 GGCCATGGCATCTCCGGGTCAGG - Intronic
903552798 1:24169633-24169655 GGACTCAGCCTCTCCGGGTCAGG + Intronic
905671740 1:39795423-39795445 AACCTCCGCCTCTCGGGTTCAGG - Intergenic
906172798 1:43741905-43741927 GACCTCTGCCTCTTCAGCTCAGG - Intronic
906359974 1:45147154-45147176 AACCTCTGCCTCTCAGGCTCAGG + Intronic
907111210 1:51928186-51928208 AACCTCCGCCTCCCCGGTTCAGG + Intronic
907336289 1:53701909-53701931 AACCTCTGCCTCTCGGGTTCAGG - Intronic
907466115 1:54638437-54638459 AACCTCGGCCTCCCGGGTTCAGG + Exonic
910404433 1:86872448-86872470 AACCTCCGCCTCTCGGGTTCAGG + Intronic
913009888 1:114672100-114672122 GGCCTCGGCCTCCCAGGCTCAGG - Intergenic
913268296 1:117066782-117066804 GACCTCTGCCTCCCAGGTTCAGG + Intronic
913485892 1:119332637-119332659 GACCTCAACATCTACGGGTCTGG + Intergenic
914243753 1:145871243-145871265 TACCTCTGCCTCTCTGGTTCAGG + Intronic
915426250 1:155829516-155829538 AACCTCTGCCTCCCCGGTTCAGG - Intronic
916233612 1:162563444-162563466 AACCTCCGCCTCCCCGGTTCAGG + Intronic
916679744 1:167093506-167093528 GGCCTCAACCTCTCAGGGTCAGG - Intergenic
917209409 1:172616283-172616305 GAGCTTGGCCTCTCCTGTTCTGG + Intergenic
917796675 1:178537915-178537937 GACCTCTGCCTCTCTGCCTCTGG + Intronic
922025257 1:221743149-221743171 GCCCGCTGCCCCTCCGGGTCTGG + Intergenic
923412120 1:233720836-233720858 GACCTCCGCCTCCCAGGTTCAGG - Intergenic
923527044 1:234780569-234780591 GGCCCGGGCCTCTCCGGGGCTGG - Intergenic
924332964 1:242958269-242958291 GACCTCTGCCTCCCAGGTTCAGG - Intergenic
924385524 1:243495571-243495593 GGCCTCGTCCCCTCCGGGTCAGG - Intronic
1064714773 10:18165492-18165514 GACCTCCGCCTCCCAGGTTCAGG + Intronic
1066114359 10:32226561-32226583 AACCTCTGCCTCTCGGGTTCAGG - Intergenic
1066585510 10:36929992-36930014 AACCTCCGCCTCTCAGGTTCAGG - Intergenic
1067212190 10:44268656-44268678 GGCCTAGGACTCTCCGAGTCAGG - Intergenic
1067553066 10:47248612-47248634 GACATTGGCCTCTGGGGGTCTGG - Intergenic
1069451212 10:68519402-68519424 GACCTCTGCCTCCCGGGTTCAGG - Intronic
1069593264 10:69654912-69654934 GACCTCCAACTCTTCGGGTCTGG + Intergenic
1072287919 10:93934391-93934413 GAGCCTGGCCTCTCCGGTTCCGG + Intronic
1072821134 10:98559108-98559130 AACCTCCGCCTCTCAGGTTCAGG + Intronic
1075124946 10:119692114-119692136 GCCCTCGGCCTCCCCAGGACAGG - Intergenic
1076791094 10:132777089-132777111 GCCCACGCCCTCTGCGGGTCTGG - Intronic
1077043824 11:535737-535759 GGCCGCGGCCTCTCGGGGTTGGG + Intronic
1077128072 11:953244-953266 AACCTCTGCCTCTCGGGTTCAGG + Intronic
1078058607 11:8029468-8029490 AACCTCTGCCTCTCAGGTTCAGG + Intronic
1078567984 11:12433734-12433756 GGCCCCGGCCTCTCTGGGTTTGG + Intronic
1079000336 11:16748661-16748683 AACCTCCGCCTCTCTGGTTCAGG - Intronic
1079058844 11:17230014-17230036 AACCTCTGCCTCCCCGGTTCAGG + Intronic
1080280792 11:30554570-30554592 AACCTCTGCCTCTCAGGTTCAGG + Intronic
1080666806 11:34343554-34343576 AACCTCTGCCTCCCAGGGTCAGG + Intronic
1081102064 11:39014642-39014664 GACCTCCACCTCTCAGGCTCAGG - Intergenic
1083725260 11:64624510-64624532 TTCCTGGGCCTCTCTGGGTCTGG - Intronic
1083815742 11:65131439-65131461 GGCCTGGGCCTCTCCTGATCTGG - Intronic
1083851701 11:65371694-65371716 AACCTCCGCCTCTCTGGTTCGGG + Intergenic
1085068013 11:73515424-73515446 AACCTCTGCCTCTCGGGTTCAGG - Intronic
1085623324 11:78053573-78053595 AACCTCGGCCTCCCAGGTTCAGG + Intronic
1087535394 11:99437739-99437761 AACCTCTGCCTCTCAGGTTCAGG - Intronic
1090370511 11:126248062-126248084 AACCTCTGCCTCTCTGGTTCAGG - Intronic
1091145118 11:133272841-133272863 AAACTTGGCTTCTCCGGGTCTGG - Intronic
1091555781 12:1572546-1572568 GACCACGGCCTCTCTGGGAATGG - Intronic
1091898587 12:4124361-4124383 GACCTCCGCCTCCCGGGTTCAGG + Intergenic
1092847273 12:12595386-12595408 GACCTCCGCCTCCCAGGTTCAGG - Intergenic
1093526779 12:20112956-20112978 GAGCTTGGCCTCTCATGGTCTGG - Intergenic
1094474896 12:30833406-30833428 GACCTCTGCCTCTCCAGGTTTGG - Intergenic
1094536790 12:31328303-31328325 AACCTCCGCCTCTCGGGTTCAGG - Intergenic
1094639217 12:32257129-32257151 AACCTCCGCCTCCCCGGTTCAGG - Intronic
1095653472 12:44641776-44641798 AACCTCTGCCTCTCGGGTTCAGG + Intronic
1096157967 12:49351816-49351838 AACCTCCGCCTCTCAGGTTCAGG - Exonic
1097116072 12:56698151-56698173 AACCTCTGCCTCCCAGGGTCAGG - Intergenic
1101108244 12:101460770-101460792 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
1101400529 12:104383035-104383057 AACCTCGGCCTCCCAGGTTCAGG + Intergenic
1101616524 12:106343306-106343328 GACCTGGGCCTCTGAAGGTCAGG + Intronic
1103341968 12:120225554-120225576 GACCTCTGCCTCTCCAAGCCCGG - Intronic
1103649463 12:122422117-122422139 GGCTTCGGCCTCCCGGGGTCCGG + Intronic
1103652065 12:122440768-122440790 AACCTCCGCCTCCCCGGTTCAGG + Intergenic
1104346160 12:128001157-128001179 TCCCTCTGCCTCTCCGGGGCTGG - Intergenic
1104385077 12:128343340-128343362 AACCTCCGCCTCTCAGGTTCAGG - Intronic
1105971915 13:25436856-25436878 AGCCTCGGCCTCTCAGGGTTAGG + Intronic
1108324250 13:49314301-49314323 GACCTCTGCCTGTCTGGGTGGGG + Intronic
1108350051 13:49583626-49583648 AACCTCTGCCTCCCCAGGTCAGG + Intronic
1110758579 13:79204794-79204816 AACCTCCGCCTCTCAGGTTCAGG - Intergenic
1114269072 14:21090554-21090576 CAGCCCTGCCTCTCCGGGTCTGG + Exonic
1116894244 14:50300374-50300396 AACCTCTGCCTCCCAGGGTCAGG + Intronic
1116932576 14:50704609-50704631 GAACTGGGCCTCTCCGGGCAAGG - Intergenic
1117525358 14:56596679-56596701 AACCTCCGCCTCTCAGGTTCAGG - Intronic
1117836876 14:59816849-59816871 AACCTCCGCCTCTCAGGCTCAGG - Intronic
1118202385 14:63688232-63688254 AACCTCGGCCTCCCGGGTTCAGG - Intronic
1118938705 14:70312778-70312800 AACCTCCGCCTCTCGGGTTCAGG + Intergenic
1122403384 14:101480939-101480961 GACCTCAGCGTCTCCTTGTCAGG + Intergenic
1122794497 14:104199289-104199311 CACCTCTGCCGCTCCGTGTCTGG - Intergenic
1122881816 14:104693701-104693723 GTCCTGGCCCTCGCCGGGTCGGG + Intronic
1123116425 14:105896197-105896219 GACCTGGACCTCACCTGGTCTGG - Intergenic
1124190083 15:27567106-27567128 AACCTCCGCCTCCCCGGTTCGGG + Intergenic
1124443780 15:29710062-29710084 AACCTCTGCCTCTCGGGTTCAGG - Intronic
1124604783 15:31161983-31162005 GACCTCCACCTCTTGGGGTCTGG + Intergenic
1124648117 15:31454177-31454199 GACCCCGGCCTCCCCGGGCCCGG + Intergenic
1127468691 15:59270459-59270481 AACCTCCGCCTCCCCGGCTCAGG - Intronic
1128284913 15:66428859-66428881 GACCTCCGCCTCCCAGGCTCTGG + Intronic
1128467054 15:67921548-67921570 AACCTCCGCCTCTCGGGTTCAGG - Intergenic
1129291244 15:74569503-74569525 GACCTCTGCCTCTTAGGTTCAGG - Intronic
1129660115 15:77548718-77548740 GGCCTCTGCCTCTACGGCTCTGG - Intergenic
1130010919 15:80152683-80152705 GACCTGGGGCTCGCGGGGTCGGG + Intronic
1130652097 15:85767980-85768002 GCCCACGGCCACTCTGGGTCCGG - Intronic
1131154990 15:90069324-90069346 AACCTCAGCCTCTCAGGCTCAGG - Intronic
1132683086 16:1151906-1151928 CCCCACAGCCTCTCCGGGTCTGG + Intergenic
1133856452 16:9553938-9553960 AACCTCTGCCTCTCAGGCTCAGG + Intergenic
1134462306 16:14439931-14439953 AACCTCCGCCTCTCGGGTTCAGG - Intronic
1135042743 16:19130408-19130430 AGCCTCGACCTCCCCGGGTCGGG - Intronic
1135384963 16:22030616-22030638 GACCTCTGCCTCCCAGGTTCAGG + Intronic
1135612163 16:23877913-23877935 AACCTCCGCCTCCCAGGGTCAGG + Intronic
1136933344 16:34437287-34437309 GGCCTGGGCCTCTCGGGGGCTGG - Intergenic
1136971228 16:34974527-34974549 GGCCTGGGCCTCTCGGGGGCTGG + Intergenic
1138379148 16:56588544-56588566 AACCTCCGCCTCCCAGGGTCAGG + Intergenic
1138616306 16:58169962-58169984 AACCTCCGCCTCTCAGGTTCAGG - Intronic
1139512858 16:67437159-67437181 AACCTTGGCCTCACCGGGCCTGG - Exonic
1139725116 16:68891376-68891398 AACCTCCGCCTCCCCGGTTCAGG - Intronic
1140209138 16:72957563-72957585 GAGCTCGGCCTCGGCGGGTGAGG + Exonic
1140286373 16:73606402-73606424 AACCTCCGCCTCTCGGGTTCAGG - Intergenic
1141568001 16:84916257-84916279 TATCCCGGCCTGTCCGGGTCTGG + Intronic
1142345296 16:89550129-89550151 GACCCCGGCCTCTCCCTGGCTGG - Intronic
1142859945 17:2755499-2755521 GACAGCGGCCTCTCCCCGTCCGG - Intergenic
1144938236 17:18917466-18917488 AACCTCGGCCTCCCAGGTTCAGG + Intronic
1146955180 17:36933190-36933212 TACCGCGGCCTCACCGAGTCTGG + Intergenic
1147314480 17:39612960-39612982 GACCTCGGTCTCTCAGCATCAGG - Intergenic
1147684165 17:42276823-42276845 GACCTCGGCCTCGGCGGGAGAGG - Intergenic
1148183808 17:45626880-45626902 AACCTCTGCCTCTCAGGTTCAGG + Intergenic
1148264927 17:46217942-46217964 AACCTCTGCCTCTCAGGTTCAGG - Intronic
1148282962 17:46363099-46363121 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
1148305179 17:46581024-46581046 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
1148919681 17:51019473-51019495 AACCTCTGCCTCCCAGGGTCAGG - Intronic
1149264273 17:54910372-54910394 AACCTCTGCCTCTCCGGTTCAGG - Intronic
1149485911 17:57042725-57042747 AACCTCTGCCTCTCAGGCTCAGG + Intergenic
1150146716 17:62775205-62775227 AACCTCTGCCTCTCGGGTTCAGG + Intronic
1150380751 17:64717454-64717476 AACCTCGGCCTCCCAGGTTCAGG - Intergenic
1150489751 17:65566119-65566141 AACCTCTGCCTCTCGGGTTCAGG - Intronic
1150780737 17:68119676-68119698 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
1150872392 17:68927174-68927196 AACCTCTGCCTCTCCAGCTCAGG - Intronic
1151334997 17:73434499-73434521 GTCCGCGGCCTCTGTGGGTCTGG + Intronic
1152044179 17:77925020-77925042 GACCTCCACCTCCCCGAGTCTGG + Intergenic
1152093283 17:78258486-78258508 GGCCTCAGCCTCTCAGAGTCAGG + Intergenic
1152485409 17:80588242-80588264 AACCTCCGCCTCTCGGGGTCAGG + Intronic
1152536154 17:80951292-80951314 GCTCTCAGTCTCTCCGGGTCAGG + Intronic
1152676603 17:81644628-81644650 GTCTGCGGCCTCCCCGGGTCAGG - Intronic
1152939124 17:83157007-83157029 AACCTCCGCCTCTCGGGTTCAGG + Intergenic
1154134608 18:11764691-11764713 GACCTCTGCCTCCCAGGCTCAGG - Intronic
1154323355 18:13371681-13371703 AACCTCCGCCTCTCGGGTTCAGG - Intronic
1155454046 18:25991901-25991923 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
1156180929 18:34602919-34602941 AACCTCTGCCTCACCGGTTCAGG - Intronic
1156325314 18:36069350-36069372 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
1160024107 18:75204745-75204767 GACCTCGGCCTCTCCGGGTCGGG + Intronic
1160580533 18:79882258-79882280 CACCTCGGCCTCTCAGTGTTAGG - Intronic
1160800571 19:966077-966099 AACCTCTGCCTCTCAGGCTCAGG - Intronic
1161184973 19:2911449-2911471 AACCTCTGCCTCTCGGGTTCAGG - Intronic
1161502808 19:4626509-4626531 AACCTCCGCCTCTCAGGTTCAGG + Intergenic
1161806476 19:6446279-6446301 AACCTCCGCCTCCCCGGTTCAGG - Intronic
1162153957 19:8664325-8664347 GTCCTTGGCCTCACCGGCTCTGG + Intergenic
1162661642 19:12173985-12174007 AACCTCTGCCTCTCGGGTTCAGG + Intronic
1162817647 19:13206095-13206117 AACCTCCGCCTCTCAGGCTCAGG + Intergenic
1164280414 19:23763548-23763570 AACCTCCGCCTCTCAGGCTCTGG + Intronic
1164638947 19:29811432-29811454 GAACTCGGCGTCTCGGGGGCGGG + Intergenic
1167345595 19:48943742-48943764 AACCTCCGCCTCTCGGGTTCAGG - Intronic
1167915165 19:52734604-52734626 GGACTCGGCCTCCCCGGGACTGG + Intronic
1167991715 19:53366134-53366156 GAACTCGGCCTCCCCGGGACCGG - Intronic
1168366637 19:55793484-55793506 AACCTCCACCTCTCCGGTTCAGG - Intronic
1168521501 19:57054437-57054459 AACCTCCGCCTCTCGGGTTCAGG - Intergenic
925480161 2:4261532-4261554 AACCTCTGCCTCCCCGGTTCAGG - Intergenic
925872174 2:8280949-8280971 AACCTCTGCCTCTCGGGTTCAGG + Intergenic
926025050 2:9534451-9534473 AACCTCTGCCTCCCCGGTTCAGG - Intronic
927538195 2:23881803-23881825 GACCTCTGCCTCCCAGGCTCAGG + Intronic
927538255 2:23882275-23882297 AACCTCTGCCTCTCGGGTTCAGG + Intronic
927774893 2:25895072-25895094 AACCTCTGCCTCCCAGGGTCAGG + Intergenic
928907379 2:36381703-36381725 AACCTCTGCCTCCCCGGTTCAGG - Intronic
930077119 2:47415541-47415563 AACCTCTGCCTCTCCGGTTTGGG + Intronic
930132041 2:47861992-47862014 GACCTCTGCCTCCCAGGTTCAGG + Intronic
930663188 2:54075729-54075751 AACCTCGGCCTCCCAGGTTCAGG - Intronic
931244935 2:60484605-60484627 GACCTCAGCCTCACCAGGTGCGG - Intronic
933830978 2:86208386-86208408 GACCTCTGCCTCACGGGTTCAGG + Intronic
934773528 2:96923048-96923070 AACCTCTGCCTCTCAGGGTCAGG + Intronic
934776018 2:96937944-96937966 GACCTTGACCTCTCGGGCTCAGG - Intronic
935201321 2:100859179-100859201 AACCTCCGCCTCTCGGGTTCAGG - Intronic
936292529 2:111237396-111237418 AACCTCTGCCTCTCAGGTTCAGG + Intergenic
938200986 2:129373030-129373052 GACCTTGGCCTCTATGGGACTGG - Intergenic
939633223 2:144550528-144550550 AACCTCCGCCTCTCAGGTTCTGG - Intergenic
939668652 2:144981537-144981559 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
943584523 2:189722255-189722277 AACCTCCGCCTCTCGGGTTCAGG - Intronic
944070145 2:195658113-195658135 GCGCACCGCCTCTCCGGGTCTGG + Intronic
946439753 2:219685285-219685307 GAGCTTGGCCTCTCCTGTTCTGG + Intergenic
947105127 2:226661210-226661232 AACCTCCGCCTCCCCGGTTCAGG + Intergenic
947496034 2:230637811-230637833 AACCTCTGCCTCTCGGGTTCAGG - Intergenic
947824499 2:233095539-233095561 GACCTCTGCCTCCCAGGTTCAGG - Intronic
948107300 2:235425662-235425684 AACCTCGGCCTCCCAGGTTCAGG + Intergenic
948138708 2:235657458-235657480 AACCTCTGCCTCTCGGGTTCAGG + Intronic
948868294 2:240786156-240786178 GCCCTCGGCCTCTCTCGGGCTGG + Intronic
948948383 2:241233443-241233465 CACCTGGGCCTCTTGGGGTCAGG - Intronic
1168753204 20:297996-298018 GTCCTCGGCCTCGCCGGGCCTGG - Exonic
1171978021 20:31607645-31607667 TTCCTGGGCCTCTGCGGGTCTGG + Intergenic
1172505392 20:35457715-35457737 AACCTCTGCCTCCCCGGTTCAGG - Intronic
1172765697 20:37349634-37349656 TCACTCGGCCTCTCTGGGTCTGG + Intronic
1172839820 20:37895901-37895923 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
1174350983 20:49967877-49967899 AACCTCCGCCTCCCAGGGTCAGG + Intergenic
1175642078 20:60639113-60639135 AACCTCAGCCTCTCAGTGTCAGG - Intergenic
1178346314 21:31831447-31831469 AACCTCCGCCTCTCAGGTTCAGG - Intergenic
1178874170 21:36400093-36400115 GACCTCCGCCTCCCAGGTTCAGG - Intronic
1179773048 21:43638374-43638396 AACCTCTGCCTCTCAGGTTCAGG - Intronic
1180193755 21:46181759-46181781 GACCACGTCCTTTCCGGGCCCGG + Intronic
1180702951 22:17791538-17791560 GACCTTGCCCTCCCCGGGGCTGG + Intronic
1183556974 22:38536132-38536154 AACCTCTGCCTCTCAGGCTCAGG - Intronic
1183694255 22:39412119-39412141 AACCTCTGCCTCTCAGGTTCAGG + Intronic
1184602972 22:45554365-45554387 GACCTGGGCATCTCTGGGGCAGG + Intronic
952785960 3:37155954-37155976 AACCTCGGCCTCCCAGGCTCAGG + Intronic
955723003 3:61903453-61903475 AACCTCCGCCTCTCGGGTTCAGG + Intronic
956418132 3:69054443-69054465 AACCTCTGCCTCCCCGGTTCAGG - Intergenic
958439165 3:94134617-94134639 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
963159337 3:142134265-142134287 AACCTCTGCCTCTCGGGTTCAGG - Intronic
965909489 3:173754126-173754148 AACCTCTGCCTCTCAGGCTCAGG + Intronic
966187862 3:177244340-177244362 AGCCTCGGCCTCTCGGGCTCAGG + Intergenic
966933452 3:184690626-184690648 GACTTCGGCTCCTCCAGGTCTGG + Intergenic
968409731 4:379454-379476 AACCTCCGCCTCTCAGGTTCAGG + Intronic
968763374 4:2454701-2454723 AACCTCTGCCTCCCAGGGTCAGG + Intronic
968944055 4:3654411-3654433 GACTTCGTCCTCTGCGGTTCTGG + Intergenic
974975180 4:68882561-68882583 AACCTCTGCCTCCCCGGTTCAGG + Intergenic
976652940 4:87455741-87455763 AACCTCTGCCTCTCGGGTTCAGG + Intronic
977273455 4:94946968-94946990 AACCTCTGCCTCCCCGGTTCAGG - Intronic
977702743 4:100038372-100038394 AACCTCAGCCTCTCAGGTTCAGG + Intergenic
981077859 4:140608515-140608537 GACCTCTGCCTCCCGGGTTCAGG - Intergenic
981405142 4:144359229-144359251 GACCTCTGCCTCCCAGGTTCAGG + Intergenic
983780253 4:171661685-171661707 AACCTCCGCCTCTCGGGTTCAGG - Intergenic
984648150 4:182241593-182241615 AACCTCCGCCTCTCAGGTTCAGG + Intronic
984755774 4:183324461-183324483 AACCTCTGCCTCCCCGGTTCAGG - Intergenic
984992347 4:185393605-185393627 AACCTCCGCCTCTCAGGTTCAGG + Intronic
985004118 4:185515980-185516002 AACCTCCGCCTCCCCGGTTCAGG + Intronic
986682461 5:10246351-10246373 AACCTCTGCCTCCCCGGTTCAGG - Intronic
987667622 5:20965126-20965148 AACCTCCGCCTCCCCGGTTCAGG - Intergenic
989079851 5:37607018-37607040 AACCTCTGCCTCTCGGGTTCAGG + Intronic
989103347 5:37839749-37839771 GACCTCGGCTTCTGGGGGTGCGG - Intergenic
991335551 5:65542553-65542575 AACCTCTGCCTCCCAGGGTCAGG - Intronic
993501903 5:88674836-88674858 GTCCTCGGCCTCTTCTGGGCCGG - Intergenic
994529112 5:100944926-100944948 AACCTCTGCCTCTCCGGTTCAGG + Intergenic
994761239 5:103856882-103856904 AACCTCTGCCTCTCAGGTTCAGG + Intergenic
995423703 5:111995048-111995070 CACCACGGCCTCTCGGGGTGTGG + Intronic
1000302916 5:159972192-159972214 GCCCTCGGCCTCGCCGAGCCCGG + Exonic
1000736322 5:164905786-164905808 TACCACGGCCTCTCTGGGCCAGG - Intergenic
1002567261 5:180119081-180119103 GCCCTCGTTCTCTCTGGGTCTGG + Intronic
1003645593 6:7910840-7910862 GGGCGCGGCCTCTCCGGGGCGGG - Intronic
1004225992 6:13784758-13784780 AACCTCTGCCTCTCGGGTTCAGG - Intergenic
1004386660 6:15178895-15178917 AACCTCTGCCTCTCTGGTTCAGG - Intergenic
1004835143 6:19522397-19522419 AACCTCCGCCTCTCAGGTTCAGG - Intergenic
1006613039 6:35306427-35306449 AACCTCTGCCTCTCGGGTTCAGG - Intronic
1006882587 6:37353216-37353238 AACCTCTGCCTCCCGGGGTCAGG + Intergenic
1007861965 6:44919958-44919980 GACCTCCGCCTCCCAGGTTCAGG + Intronic
1008619217 6:53255409-53255431 AACCTCCGCCTCTCAGGCTCAGG + Intergenic
1011793926 6:90931886-90931908 GACCTCGGTCTCTCCGCTTAAGG + Intergenic
1012486919 6:99732433-99732455 AACCTCCGCCTCCCAGGGTCAGG + Intergenic
1012615402 6:101272187-101272209 AACCTCTGCCTCCCGGGGTCAGG + Intergenic
1018168746 6:161126976-161126998 GAGCTCAGCCTCTCCTGGGCAGG + Intergenic
1019562912 7:1666945-1666967 GACCCTAGCCTCTCCCGGTCCGG + Intergenic
1020269254 7:6583096-6583118 AACCTCTGCCTCTCAGGTTCAGG - Intronic
1021890044 7:25178957-25178979 GACCTCTGCCTCCCAGGTTCAGG - Intronic
1025860147 7:65319021-65319043 AACCTCTGCCTCTCGGGTTCAGG - Intergenic
1026458947 7:70596394-70596416 TGCCTCTGCCTCCCCGGGTCTGG - Intronic
1027190538 7:75993630-75993652 GCCCTTGGCCTCTCCTGGACTGG - Intronic
1027202494 7:76072605-76072627 GACAGCGGCCTCTCCGGGCCCGG - Intergenic
1027402929 7:77827434-77827456 GACCTCTGCCTCCCGGGTTCAGG + Intronic
1027762915 7:82302494-82302516 GACCTCTGCCTCCCGGGTTCAGG + Intronic
1028223888 7:88227421-88227443 GACCTCTGCCTCCCCAGTTCAGG + Intergenic
1028279587 7:88905437-88905459 AACCTCGGCCTCCCTGGTTCAGG + Intronic
1029327805 7:99824677-99824699 AACCTCTGCCTCTCGGGCTCAGG + Intergenic
1029450589 7:100640159-100640181 AACCTCCGCCTCCCCGGCTCAGG + Intronic
1031021666 7:116635466-116635488 GACCTCTGCCTCCCAGGTTCTGG - Intergenic
1033682136 7:143604907-143604929 TACCTCTGCCTCCCAGGGTCTGG + Intergenic
1033702754 7:143857006-143857028 TACCTCTGCCTCCCAGGGTCTGG - Intronic
1034201023 7:149283050-149283072 AACCTCCGCCTCTCGGGTTCAGG + Exonic
1035149528 7:156856638-156856660 GACCTCTGCCTCTCAGATTCAGG - Intronic
1035193971 7:157199550-157199572 AACCTCAGCCTCTCAGGTTCAGG + Intronic
1035315254 7:157993574-157993596 GACCTCTGGCTCTCCAGGCCTGG - Intronic
1037917229 8:22780028-22780050 AACCTCTGCCTCTCTGGCTCAGG + Intronic
1038109932 8:24484885-24484907 AACCTCCGCCTCTCGGGTTCAGG + Intronic
1039060396 8:33567542-33567564 AACCTCTGCCTCTCGGGTTCAGG + Intergenic
1039812719 8:41063736-41063758 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
1039861746 8:41465357-41465379 AACCTCCGCCTCTCAGGTTCAGG - Intergenic
1039938519 8:42068839-42068861 AACCTCCGCCTCTCAGGTTCAGG - Intergenic
1042937628 8:74076403-74076425 GACCTCCGCCTCCCGGGTTCAGG + Intergenic
1045128022 8:99116107-99116129 AACCTCTGCCTCTCAGGTTCAGG + Intronic
1046697092 8:117353301-117353323 GACCTCCGCCTCCCAGGTTCAGG - Intergenic
1049543972 8:143221032-143221054 GACCTCGGGCTGACCGGCTCAGG - Intergenic
1049591226 8:143463733-143463755 GGACTCTGCGTCTCCGGGTCTGG + Intronic
1050536569 9:6635791-6635813 AACCTCGACCTCTCCGGCTCAGG - Intronic
1051272224 9:15366629-15366651 AACCTCCGCCTCTCAGGTTCAGG + Intergenic
1052293417 9:26870696-26870718 AACCTCTGCCTCCCCGGTTCAGG + Intronic
1053135373 9:35647268-35647290 GACCTGGGCCTCTCCTGGGGAGG + Intergenic
1061079106 9:128359541-128359563 AACCTCGGCCTCCCGGGTTCAGG - Intronic
1061232176 9:129321351-129321373 GCCCTGGGCCCCTCCGGGACTGG + Intergenic
1061508794 9:131048136-131048158 AACCTCCGCCTCTCGGGTTCAGG + Intronic
1061588387 9:131583149-131583171 GACCTCGCCCTCCCCAGGGCTGG + Intronic
1061836190 9:133331753-133331775 GACCTCGGCCTCTCCATGTGAGG - Exonic
1061851348 9:133417883-133417905 GACCCCGGCCTCCCCGGGCCCGG + Exonic
1062363670 9:136199049-136199071 GGCCTCGGCCTCTGCGCGGCGGG + Exonic
1062382628 9:136294771-136294793 GGCCACGGCCTCTCCAGGACAGG + Intronic
1185800340 X:3004989-3005011 AACCTCCGCCTCTCAGGTTCAGG + Intergenic
1187052833 X:15711838-15711860 GACCTCAGCCTCCCAGGTTCAGG + Intronic
1187481399 X:19659194-19659216 AACCTCTGCCTCTCGGGTTCAGG + Intronic
1187882403 X:23859523-23859545 AACCTCTGCCTCTCGGGTTCAGG + Intronic
1188249471 X:27875158-27875180 AACCTCCGCCTCTCGGGTTCCGG + Intergenic
1189108455 X:38261174-38261196 AACCTCCGCCTCTCAGGTTCAGG + Intronic
1190024723 X:46912736-46912758 AACCTCGCCCGCGCCGGGTCCGG - Intronic
1190088574 X:47417844-47417866 AACCTCTGCCTCTCAGGTTCAGG + Intergenic
1190868567 X:54405601-54405623 AACCTCTGCCTCTCAGGTTCAGG - Intergenic
1198952700 X:142090336-142090358 AACCTCTGCCTCTCGGGTTCCGG + Intergenic
1201342403 Y:12948590-12948612 AACCTCAGCCTCTCAGGTTCAGG - Intergenic