ID: 1160024110

View in Genome Browser
Species Human (GRCh38)
Location 18:75204749-75204771
Sequence TCGGCCTCTCCGGGTCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160024098_1160024110 18 Left 1160024098 18:75204708-75204730 CCGCGGTGGAGTTGAGATTCCTC 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1160024110 18:75204749-75204771 TCGGCCTCTCCGGGTCGGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 90
1160024100_1160024110 -1 Left 1160024100 18:75204727-75204749 CCTCAGGCCTGCGACCGTGACCT 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1160024110 18:75204749-75204771 TCGGCCTCTCCGGGTCGGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 90
1160024097_1160024110 24 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024110 18:75204749-75204771 TCGGCCTCTCCGGGTCGGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 90
1160024096_1160024110 25 Left 1160024096 18:75204701-75204723 CCCGGCGCCGCGGTGGAGTTGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1160024110 18:75204749-75204771 TCGGCCTCTCCGGGTCGGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 90
1160024102_1160024110 -8 Left 1160024102 18:75204734-75204756 CCTGCGACCGTGACCTCGGCCTC 0: 1
1: 0
2: 0
3: 14
4: 78
Right 1160024110 18:75204749-75204771 TCGGCCTCTCCGGGTCGGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160024110 Original CRISPR TCGGCCTCTCCGGGTCGGGC GGG Intronic
900292588 1:1929808-1929830 CCTGCCTCTCGGGGTCAGGCTGG + Intronic
900368726 1:2322092-2322114 TGGGGCTCTCCGGGTGGGGCTGG + Intronic
900532506 1:3161640-3161662 CCGGCCTCTCCGCGCCGGGCGGG - Intronic
901934164 1:12616592-12616614 TGGGCCTCTCAGTGTCGGTCCGG + Intronic
904617141 1:31756049-31756071 TCGGCCTCAGCAGGTGGGGCTGG + Exonic
906242230 1:44249109-44249131 TGGGCTTCTCCGGGTAGGCCTGG + Intronic
906518916 1:46455965-46455987 TCCATCTCTGCGGGTCGGGCGGG + Intergenic
912385457 1:109269130-109269152 TGGGCCTCTCCGGGGCCTGCGGG - Exonic
912413408 1:109492831-109492853 TCAGCCTCCCAGGGTAGGGCTGG - Intergenic
916656032 1:166876075-166876097 CGGGCGTCTCCGGGGCGGGCTGG + Intronic
917974596 1:180230659-180230681 TCAGCCGCTGCGGGGCGGGCCGG + Intronic
923730701 1:236547073-236547095 CTGGCCTCTCGGGGTGGGGCCGG + Intronic
1069942390 10:71964526-71964548 GCGTCTTCTCCGGGGCGGGCCGG - Exonic
1070813871 10:79311524-79311546 TCTGCCTCTCTGGCCCGGGCAGG + Intronic
1077062882 11:625489-625511 TCGGCTTCTCAGGGCGGGGCTGG + Intronic
1077299097 11:1839041-1839063 CCGGCCTCGGCGGGCCGGGCTGG - Intronic
1078468371 11:11567616-11567638 TGGGCATCTCCTGGTGGGGCTGG - Intronic
1083260092 11:61518171-61518193 TGGGCCTCTCCTGGCCAGGCCGG + Exonic
1083595418 11:63916537-63916559 GCGACCTCTCCAGGCCGGGCCGG - Exonic
1083922073 11:65786598-65786620 TCGGGCGCGCCGGGTTGGGCCGG + Intergenic
1087046838 11:93850128-93850150 CCGGGCTCGCCGGGTGGGGCGGG + Intronic
1095180787 12:39144920-39144942 GCGGCCTCTCCGGGACCGGCTGG - Intergenic
1095703745 12:45216503-45216525 TCGGCCGCTCCGGGCAGGGGAGG + Intronic
1102456115 12:113071752-113071774 TCCGCCTCTCCGGCCCAGGCTGG - Intronic
1104285750 12:127423158-127423180 TCGGCTTCTCAGGGTCAGGGCGG - Intergenic
1104633511 12:130424282-130424304 GCGGCCTCTCCGGGCCGGGCTGG + Intronic
1105492584 13:20902867-20902889 GCGGCCTCGGCGGGTCTGGCCGG + Intronic
1106076279 13:26464058-26464080 TCGGCCTCTCTGGCCAGGGCTGG + Intergenic
1108693808 13:52885049-52885071 TCGGCCTCTCTGGGTAAGCCAGG - Intergenic
1112509659 13:99997968-99997990 CCGGCCTCCCCAGGTCCGGCTGG + Intergenic
1114452693 14:22837389-22837411 TCGGCCTCCCCGGGTGGCCCAGG + Intronic
1128161125 15:65423196-65423218 TCGCCCTCTCCGGGTCGCCGCGG + Intergenic
1132554640 16:567093-567115 CCGGCCTCTCTCGGTGGGGCAGG + Intronic
1132583361 16:695169-695191 GCGGCTGCTCCGGGTGGGGCAGG - Intronic
1133403026 16:5502496-5502518 TCTGCTTCTCTGGGTCTGGCTGG + Intergenic
1134509375 16:14834064-14834086 TCAGCCTCTCTGGGCCGCGCTGG + Intronic
1134697080 16:16232879-16232901 TCAGCCTCTCTGGGCCGCGCTGG + Intronic
1134974763 16:18561806-18561828 TCAGCCTCTCTGGGCCGCGCTGG - Intronic
1135592324 16:23713249-23713271 GAGCCTTCTCCGGGTCGGGCGGG - Exonic
1141568005 16:84916261-84916283 CCGGCCTGTCCGGGTCTGGGTGG + Intronic
1141839387 16:86565207-86565229 TCGGCCTCTTCGCTTCGGGGAGG - Intergenic
1143018305 17:3903608-3903630 TCGGCCTCTCGGAGAAGGGCAGG + Exonic
1145977798 17:28994223-28994245 CCGGCCTCTCTGGGCCTGGCCGG + Intronic
1147548488 17:41421458-41421480 TCTGCCGCTCCAGGTCGGCCCGG + Exonic
1147987684 17:44315748-44315770 TGGGCATCTCGGGGTGGGGCTGG - Intronic
1148337396 17:46851243-46851265 TCTGCCTCTCCGGGATGGGGCGG - Intronic
1151671780 17:75574940-75574962 CCGGCCTCTCCGGTTGGGGCAGG - Exonic
1152078165 17:78171127-78171149 TCGGCCTCTCTGGGAGGGGCAGG + Intronic
1152493594 17:80654414-80654436 TCGGCCTCTCTGGGTTGGGAAGG - Intronic
1152536155 17:80951296-80951318 TCAGTCTCTCCGGGTCAGGATGG + Intronic
1152707334 17:81851427-81851449 TCTGCCCCTCGGGTTCGGGCAGG - Intronic
1154103610 18:11500033-11500055 TCGGCCTCTCCTGGAAGCGCTGG + Intergenic
1154501838 18:15001225-15001247 TAGGCCTCTCAGGGTCTGGCCGG + Intergenic
1160024110 18:75204749-75204771 TCGGCCTCTCCGGGTCGGGCGGG + Intronic
1160793256 19:932653-932675 GCGGCCCCTCCGGGGTGGGCAGG - Exonic
1161215874 19:3094842-3094864 CCTGCCTGTCCGGGTCGGGCCGG + Intronic
1161215921 19:3094991-3095013 ACTGCCTGTCCGGGTCGGGGCGG + Intronic
1161595355 19:5148544-5148566 TCGGCCTCTCGGCTTCTGGCAGG - Intronic
1163243260 19:16076912-16076934 GCGCCGCCTCCGGGTCGGGCGGG + Intronic
1163573524 19:18097665-18097687 TCGGGCTCCCCGGGAGGGGCGGG + Intronic
1164638949 19:29811436-29811458 TCGGCGTCTCGGGGGCGGGGAGG + Intergenic
1165078842 19:33296383-33296405 CAGGCCTCTCCGGGTTTGGCTGG - Intergenic
1165086120 19:33348739-33348761 TCAGGCTTTCCGGGTTGGGCTGG + Intergenic
1165311169 19:35030309-35030331 CCGGCCTCTCCGGGTGGCGCAGG - Intergenic
925149466 2:1605332-1605354 GCGGCCTCTGCGCGCCGGGCAGG + Intergenic
927562528 2:24084155-24084177 TCAGCCGCGCCGGGGCGGGCGGG - Intronic
929781149 2:44957938-44957960 TCCACCTCTCCGGGTCAGTCAGG + Intergenic
938501019 2:131831394-131831416 TGGGCCTCTCAGGGTCTGGCCGG + Intergenic
941905579 2:170714678-170714700 TCGGCCCCACCGCGGCGGGCGGG + Intergenic
942228141 2:173834811-173834833 TCAGCCTCTCAGGGCAGGGCCGG - Intergenic
1168753202 20:297992-298014 TCGGCCTCGCCGGGCCTGGCCGG - Exonic
1170639328 20:18137900-18137922 GCGGCCTCTGCGCCTCGGGCGGG + Exonic
1174395801 20:50246290-50246312 TCAGCCTTTCTGGGTCTGGCTGG + Intergenic
1176061691 20:63175453-63175475 GCGGACTCTGCGGGGCGGGCGGG + Intergenic
1176550563 21:8219148-8219170 TCGTCCGCTCCGGGCCGGGACGG + Intergenic
1176569493 21:8402189-8402211 TCGTCCGCTCCGGGCCGGGACGG + Intergenic
1176577405 21:8446418-8446440 TCGTCCGCTCCGGGCCGGGACGG + Intergenic
1179495120 21:41766671-41766693 TCGGCCTGTCCGGGCCGGAGGGG - Intronic
1180046744 21:45309900-45309922 CCGGGCTCTCCAGGGCGGGCAGG - Intergenic
1181038600 22:20181594-20181616 TCGCTCTCTCCAGGTCAGGCTGG + Intergenic
1182112352 22:27732655-27732677 CTGGCCTCTCCAGGTCAGGCTGG - Intergenic
1183586414 22:38755638-38755660 TCCTCCTCTCCGGGACGTGCTGG - Intronic
1203255462 22_KI270733v1_random:135491-135513 TCGTCCGCTCCGGGCCGGGACGG + Intergenic
959398332 3:105868943-105868965 GCGGCCTCCCCGAGTCGGGCGGG - Exonic
965882064 3:173397879-173397901 CCGGTCTCTCCGGCTCGGACGGG - Intronic
969444813 4:7238814-7238836 ACGGCCTCCCTGGGTTGGGCTGG + Intronic
978189536 4:105895894-105895916 GCGCCCTCTCCGCCTCGGGCGGG - Intronic
1001845274 5:174916560-174916582 TGAGCCCCTCCGGGTAGGGCTGG - Intergenic
1005328108 6:24721328-24721350 TCAGCCTCTCAGAGTCAGGCTGG + Intergenic
1006196488 6:32245880-32245902 TCTGCCTCTCAGGGTTGGACAGG + Intergenic
1007423514 6:41733718-41733740 TCTGCCTCTCCTGGCCGGCCAGG + Intronic
1007779813 6:44246388-44246410 TCCGCCTCTCCGGCTGCGGCCGG - Intronic
1018390149 6:163335758-163335780 TCAGGCTCTCCGGGCCAGGCTGG - Intergenic
1029111728 7:98216180-98216202 TCTGCCTCGCCTGGCCGGGCCGG + Exonic
1037717268 8:21411076-21411098 CCAGCCTCTGCGGGTCTGGCTGG - Intergenic
1041689984 8:60679070-60679092 TCGCGCTCACCGGGTCGGTCGGG - Exonic
1049487951 8:142876205-142876227 TCACCCTCTCTGGGTGGGGCTGG + Intronic
1049492840 8:142914228-142914250 TCACCCTCTCTGGGTGGGGCTGG + Intronic
1056809940 9:89756541-89756563 TCAGCCTCTCCGGGTGGGTTCGG - Intergenic
1059176650 9:112174904-112174926 CCGGCGTCGCGGGGTCGGGCGGG + Intronic
1062309594 9:135928809-135928831 TTGGCCTCTCTGGGGTGGGCGGG - Intergenic
1062472490 9:136712586-136712608 GCGGCCGCTGCGGGCCGGGCCGG + Exonic
1062498650 9:136843125-136843147 TGGGCCTCTCGGGGTCTGGCCGG - Intronic
1203471858 Un_GL000220v1:118626-118648 TCGTCCGCTCCGGGCCGGGACGG + Intergenic
1196965111 X:121047426-121047448 GCGGCCTCGCCGGGCCTGGCTGG - Intergenic