ID: 1160024111

View in Genome Browser
Species Human (GRCh38)
Location 18:75204750-75204772
Sequence CGGCCTCTCCGGGTCGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160024098_1160024111 19 Left 1160024098 18:75204708-75204730 CCGCGGTGGAGTTGAGATTCCTC 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1160024111 18:75204750-75204772 CGGCCTCTCCGGGTCGGGCGGGG 0: 1
1: 0
2: 2
3: 15
4: 140
1160024097_1160024111 25 Left 1160024097 18:75204702-75204724 CCGGCGCCGCGGTGGAGTTGAGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1160024111 18:75204750-75204772 CGGCCTCTCCGGGTCGGGCGGGG 0: 1
1: 0
2: 2
3: 15
4: 140
1160024096_1160024111 26 Left 1160024096 18:75204701-75204723 CCCGGCGCCGCGGTGGAGTTGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1160024111 18:75204750-75204772 CGGCCTCTCCGGGTCGGGCGGGG 0: 1
1: 0
2: 2
3: 15
4: 140
1160024102_1160024111 -7 Left 1160024102 18:75204734-75204756 CCTGCGACCGTGACCTCGGCCTC 0: 1
1: 0
2: 0
3: 14
4: 78
Right 1160024111 18:75204750-75204772 CGGCCTCTCCGGGTCGGGCGGGG 0: 1
1: 0
2: 2
3: 15
4: 140
1160024100_1160024111 0 Left 1160024100 18:75204727-75204749 CCTCAGGCCTGCGACCGTGACCT 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1160024111 18:75204750-75204772 CGGCCTCTCCGGGTCGGGCGGGG 0: 1
1: 0
2: 2
3: 15
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160024111 Original CRISPR CGGCCTCTCCGGGTCGGGCG GGG Intronic
903907616 1:26697234-26697256 CGGCCCCTCCGCGGCCGGCGGGG + Exonic
904581029 1:31544466-31544488 CGGCCTCTGAGGGTCAGGCCAGG - Intergenic
906637007 1:47416479-47416501 CCGCCGCCCCGGGCCGGGCGCGG - Exonic
910892207 1:92029961-92029983 CGGCCGCCCCGGGCCGGGGGAGG + Exonic
922250722 1:223846283-223846305 CGGCGGCTCCGAGTCGTGCGAGG + Intergenic
923730702 1:236547074-236547096 TGGCCTCTCGGGGTGGGGCCGGG + Intronic
1064130913 10:12708929-12708951 ATGCAACTCCGGGTCGGGCGTGG - Intronic
1076680279 10:132168163-132168185 GGGCTTCTCCGGGACGGGCCTGG + Exonic
1077043826 11:535742-535764 CGGCCTCTCGGGGTTGGGCTTGG + Intronic
1077250084 11:1557067-1557089 CGGGCTGTCCGGGCTGGGCGAGG + Exonic
1077299096 11:1839040-1839062 CGGCCTCGGCGGGCCGGGCTGGG - Intronic
1081558993 11:44195142-44195164 TGGCCTTTCCTGGCCGGGCGCGG + Intronic
1081973220 11:47214456-47214478 AGGCCTCTGCGGGTCCGGGGAGG - Intronic
1083595417 11:63916536-63916558 CGACCTCTCCAGGCCGGGCCGGG - Exonic
1085666215 11:78417610-78417632 CGGCCGCCCAGGGGCGGGCGGGG - Intronic
1091923058 12:4321110-4321132 AGGCCACTCAGGGCCGGGCGAGG - Intergenic
1092906047 12:13101399-13101421 CTTCCTGACCGGGTCGGGCGGGG + Intronic
1095180786 12:39144919-39144941 CGGCCTCTCCGGGACCGGCTGGG - Intergenic
1101870576 12:108562438-108562460 ACGCCTCTCGGGGGCGGGCGGGG - Intergenic
1104633512 12:130424283-130424305 CGGCCTCTCCGGGCCGGGCTGGG + Intronic
1105492585 13:20902868-20902890 CGGCCTCGGCGGGTCTGGCCGGG + Intronic
1112507280 13:99982472-99982494 CGGGCTGTTCGGGCCGGGCGCGG + Exonic
1115029136 14:28774019-28774041 GGGCTGCTCCGGGTCGGGTGAGG + Intronic
1119519702 14:75277108-75277130 CGGCCTCCCCGGCCCGGCCGCGG - Intergenic
1122093058 14:99352727-99352749 TGGCCTCTCCCGGCCGGGCGCGG - Intergenic
1122657681 14:103273349-103273371 AGGCCTCCGCGGATCGGGCGGGG - Intergenic
1122881820 14:104693706-104693728 GGCCCTCGCCGGGTCGGGGGTGG + Intronic
1123067142 14:105624425-105624447 CGGGCTCTCGGGGTCGCGCGAGG - Intergenic
1123071164 14:105643152-105643174 CAGGCTCTCGGGGTCGCGCGAGG - Intergenic
1123090824 14:105741422-105741444 CAGGCTCTCGGGGTCGCGCGAGG - Intergenic
1123096460 14:105769186-105769208 CGGGCTCTCGGGGTCGCGCGAGG - Intergenic
1124973708 15:34514627-34514649 CGGCCTCGCGGGGCAGGGCGAGG - Intergenic
1127790130 15:62391594-62391616 AGGCCTCTCCGACTGGGGCGCGG - Intronic
1129687733 15:77696164-77696186 CGGCCTCTCCAGGGAGGGGGCGG + Intronic
1130270764 15:82445768-82445790 CGGCCTCACGGGGCAGGGCGAGG + Intergenic
1130463106 15:84173091-84173113 CGGCCTCACGGGGCAGGGCGAGG + Intronic
1130489568 15:84421697-84421719 CGGCCTCACGGGGCAGGGCGAGG - Intergenic
1130501159 15:84500459-84500481 CGGCCTCACGGGGCAGGGCGAGG - Intergenic
1131061455 15:89407215-89407237 CGGCCTCTCCTCGACGCGCGCGG - Intergenic
1131063924 15:89421340-89421362 CTGCCTCTCAGGGTGGTGCGAGG - Intergenic
1132186658 15:99806866-99806888 CGGCCTCGCAGGGCAGGGCGGGG + Intergenic
1132429029 15:101745845-101745867 CGGCCTCGCAGGGCAGGGCGGGG - Intergenic
1132548710 16:545370-545392 CGGCCTCTCTCGGTGGGCCGAGG - Intronic
1132831352 16:1929895-1929917 CGGCCTCCCGGGCCCGGGCGCGG - Intergenic
1135517566 16:23148746-23148768 AGGCTGCTCCGGGTCAGGCGAGG + Exonic
1135592323 16:23713248-23713270 AGCCTTCTCCGGGTCGGGCGGGG - Exonic
1136278203 16:29191888-29191910 CTGCCTCTCCGGGACAGGAGAGG - Intergenic
1136524606 16:30820963-30820985 GGCCCTCTCCGGGGTGGGCGTGG - Intergenic
1139534316 16:67562302-67562324 CGCCCTCGCCGGGTCGCTCGTGG - Intergenic
1142299482 16:89247932-89247954 CGGCGTCTACGGGGCGAGCGAGG + Intergenic
1142377193 16:89712158-89712180 CGGCCTCTCCGGGTGTGGGACGG - Intronic
1143452450 17:7043776-7043798 CGACCTCTCCGGGCGGTGCGGGG + Exonic
1143493096 17:7294921-7294943 TGGCCTCTGCGGGAAGGGCGGGG + Intergenic
1144515975 17:15917767-15917789 CGACCGCTCCGGGCCTGGCGCGG + Intergenic
1144601401 17:16617876-16617898 CGGCATGTCCGTGGCGGGCGGGG + Intergenic
1145254820 17:21316757-21316779 CGGGCGCTCGGGGCCGGGCGGGG - Intergenic
1145321780 17:21771208-21771230 CGGGCGCTCGGGGCCGGGCGGGG + Intergenic
1148013389 17:44503579-44503601 GGGTCGCTCCGGGTCGCGCGCGG - Intergenic
1151671779 17:75574939-75574961 CGGCCTCTCCGGTTGGGGCAGGG - Exonic
1152078166 17:78171128-78171150 CGGCCTCTCTGGGAGGGGCAGGG + Intronic
1152529271 17:80907521-80907543 CGGCCTCTCTGGGTCCAGCGTGG + Intronic
1152732080 17:81977452-81977474 CGCGCTTTCCGGGTCTGGCGCGG + Intronic
1153226610 18:2905282-2905304 CTGCCTCTGTGGGTGGGGCGGGG + Intronic
1154501839 18:15001226-15001248 AGGCCTCTCAGGGTCTGGCCGGG + Intergenic
1155954104 18:31942853-31942875 CGGCCTGGCCCGGCCGGGCGGGG + Exonic
1156502208 18:37566962-37566984 CGCGCTCTCCGGGGCGGGGGAGG - Intergenic
1160024111 18:75204750-75204772 CGGCCTCTCCGGGTCGGGCGGGG + Intronic
1160793255 19:932652-932674 CGGCCCCTCCGGGGTGGGCAGGG - Exonic
1160830907 19:1104514-1104536 GGGCGTCTCCGGGCCGAGCGGGG + Intronic
1161215875 19:3094843-3094865 CTGCCTGTCCGGGTCGGGCCGGG + Intronic
1161215922 19:3094992-3095014 CTGCCTGTCCGGGTCGGGGCGGG + Intronic
1161772928 19:6241241-6241263 CGGGCTCTCGGGATGGGGCGGGG - Intronic
1162471126 19:10872298-10872320 GGGCGTCTCGGGGGCGGGCGTGG + Intronic
1162731740 19:12722355-12722377 CGGCCTTTCCCGGTCGGGCGCGG + Intronic
1163243261 19:16076913-16076935 CGCCGCCTCCGGGTCGGGCGGGG + Intronic
1163573525 19:18097666-18097688 CGGGCTCCCCGGGAGGGGCGGGG + Intronic
1165311168 19:35030308-35030330 CGGCCTCTCCGGGTGGCGCAGGG - Intergenic
1167946483 19:52992899-52992921 CGGCCTCCTCGGGACGGGGGAGG + Intergenic
928420895 2:31137518-31137540 CGGCCTCCCCAGGTCGGGCCTGG + Intronic
929540014 2:42811751-42811773 CGACCTCCCCGGGGCTGGCGAGG - Intergenic
930046236 2:47175787-47175809 CGGCGGCTCCGGGTCCCGCGAGG + Intronic
935196680 2:100820375-100820397 CGGCCCCGCGGGGCCGGGCGCGG - Exonic
935237502 2:101151100-101151122 GGGGCTCGCCGGGGCGGGCGCGG - Intronic
938501020 2:131831395-131831417 GGGCCTCTCAGGGTCTGGCCGGG + Intergenic
941905580 2:170714679-170714701 CGGCCCCACCGCGGCGGGCGGGG + Intergenic
945748427 2:213748856-213748878 AAGCCTCTCAGGGTGGGGCGTGG + Intronic
947167041 2:227273095-227273117 CGGCTTCTCCGGGTGGTCCGGGG - Exonic
1168753201 20:297991-298013 CGGCCTCGCCGGGCCTGGCCGGG - Exonic
1169074514 20:2752610-2752632 CAACCTCTCCGGGATGGGCGGGG - Intronic
1172389849 20:34559135-34559157 CCGCCCCTCCGGGACAGGCGGGG + Intronic
1173488347 20:43458017-43458039 CGGCATGTCCGTGGCGGGCGGGG - Exonic
1175922558 20:62456977-62456999 CAGCCTCTCCGGGCCAGGGGAGG - Intergenic
1176061692 20:63175454-63175476 CGGACTCTGCGGGGCGGGCGGGG + Intergenic
1176548109 21:8210121-8210143 CTACCTCCCCGGGTCGGGAGTGG - Intergenic
1176556002 21:8254331-8254353 CTACCTCCCCGGGTCGGGAGTGG - Intergenic
1176567040 21:8393156-8393178 CTACCTCCCCGGGTCGGGAGTGG - Intergenic
1176574939 21:8437366-8437388 CTACCTCCCCGGGTCGGGAGTGG - Intergenic
1176611553 21:8988662-8988684 CTACCTCCCCGGGTCGGGAGTGG - Intergenic
1182667849 22:31972343-31972365 CAGCCAATCCGCGTCGGGCGGGG - Intergenic
1183547516 22:38462686-38462708 TGGCCTCTACAGGCCGGGCGCGG + Intergenic
1183856120 22:40636366-40636388 CGTCCTCGGGGGGTCGGGCGAGG - Intronic
1185417976 22:50720437-50720459 CGGCCTGTACGAGCCGGGCGCGG + Intergenic
1203252988 22_KI270733v1_random:126421-126443 CTACCTCCCCGGGTCGGGAGTGG - Intergenic
1203261043 22_KI270733v1_random:171502-171524 CTACCTCCCCGGGTCGGGAGTGG - Intergenic
949552402 3:5122254-5122276 CGGCGGCGCCGGGACGGGCGTGG + Exonic
949779448 3:7669576-7669598 CTGCCTCTCAGGGTCTGGCAAGG + Intronic
950032733 3:9863007-9863029 CGGCCTCTGGGGGTCAGACGGGG - Intergenic
954249737 3:49358421-49358443 CGAGCCCTCCGGGTAGGGCGGGG - Exonic
960223737 3:115146926-115146948 CCTCCCCGCCGGGTCGGGCGAGG + Intronic
965521176 3:169669226-169669248 CGCCCTCTCCGGGCTCGGCGCGG + Intergenic
966411831 3:179653088-179653110 CGGCCGAGCCGGGGCGGGCGGGG - Exonic
969444814 4:7238815-7238837 CGGCCTCCCTGGGTTGGGCTGGG + Intronic
969529380 4:7722285-7722307 CAGCCTCTCAGGGAGGGGCGGGG - Intronic
979666522 4:123316933-123316955 AGGCCTCTCTGGGCTGGGCGCGG + Exonic
987193193 5:15500229-15500251 CGGCTTCCCCGGGGAGGGCGCGG - Exonic
989230020 5:39074582-39074604 CGTGCCCTCCGGGTCCGGCGTGG - Intergenic
994670366 5:102755487-102755509 CGGGCTGCCCGGGTCGGGGGTGG + Intronic
996397978 5:123032382-123032404 AGGGCTCTCCGGGTCGAGCCAGG + Intronic
997635200 5:135399353-135399375 CGGCGTCAACGGGTAGGGCGCGG - Exonic
999248375 5:150167244-150167266 CGGCCTCTGCGCTCCGGGCGAGG - Exonic
1018727752 6:166627024-166627046 CGGCTGCTCCGGGCTGGGCGCGG - Intronic
1018910788 6:168100101-168100123 CAGCCACTCCAGGTGGGGCGGGG - Intergenic
1019637264 7:2082530-2082552 CGGCGTCGCCGGGTCTGGTGTGG + Intronic
1020112009 7:5452545-5452567 CGGCCTCTCTGGGCAGAGCGGGG - Intronic
1021678543 7:23105980-23106002 GGGGCTCGCCGGGCCGGGCGAGG - Exonic
1022427861 7:30285243-30285265 GGGCCTCTCTGGGCCGGCCGCGG + Exonic
1022697945 7:32728456-32728478 GGGCCTCTCTGGGCCGGCCGCGG + Intergenic
1024216700 7:47254558-47254580 CGGGCTCGCCGGGCGGGGCGGGG - Intergenic
1027270277 7:76515123-76515145 CGGCCTCTCTGGGTGGGATGTGG - Exonic
1028883645 7:95908610-95908632 TGGCCTCTCTGGGTGGGGCGAGG + Intronic
1029687295 7:102157487-102157509 AGGACTCTCCAGGCCGGGCGCGG + Intronic
1032586815 7:133154436-133154458 TGGCCTTTCCAGGCCGGGCGCGG - Intergenic
1038370228 8:26981665-26981687 GGGCCTGTCGGGGTTGGGCGGGG + Intergenic
1039466685 8:37789581-37789603 CTGCCTCTCAGGGCCAGGCGCGG + Intronic
1040107769 8:43550013-43550035 CGTCCTGTCCCGGTCAGGCGGGG + Intergenic
1040111906 8:43570423-43570445 CGACCCCTCCAGGTTGGGCGCGG + Intergenic
1044734798 8:95268742-95268764 CGGGCTCTGCGGGCGGGGCGGGG + Intronic
1045047516 8:98293870-98293892 CGGCCTCTCCGAGTGGGAAGAGG - Intronic
1049060123 8:140270199-140270221 AGGCCTCTCCGGGAAGGGGGCGG + Intronic
1049109858 8:140635803-140635825 CGGCGGCGCCGGGTCTGGCGGGG + Intergenic
1050181169 9:2924264-2924286 CTGGCTCTCCGGGTGGGGGGAGG - Intergenic
1058058602 9:100473387-100473409 CGGACGCTGCGGGTGGGGCGGGG + Exonic
1059176651 9:112174905-112174927 CGGCGTCGCGGGGTCGGGCGGGG + Intronic
1059633897 9:116154245-116154267 GGGTCTCTCCGGGCCCGGCGGGG - Exonic
1061089914 9:128420771-128420793 CGCCCTCTCCGGGTCTGCCTCGG + Exonic
1061190817 9:129081546-129081568 CGGCCTCTCTGGGACAGGGGAGG - Intronic
1062309593 9:135928808-135928830 TGGCCTCTCTGGGGTGGGCGGGG - Intergenic
1062472491 9:136712587-136712609 CGGCCGCTGCGGGCCGGGCCGGG + Exonic
1062498649 9:136843124-136843146 GGGCCTCTCGGGGTCTGGCCGGG - Intronic
1062527785 9:136985259-136985281 CAGCCTGTCTGGGTCGGGGGAGG + Exonic
1062610406 9:137370985-137371007 CGGCCTCTTTCGGCCGGGCGCGG + Intronic
1062627012 9:137447982-137448004 GGGCCTCGCCGGGTCTGGAGGGG - Exonic
1203469390 Un_GL000220v1:109568-109590 CTACCTCCCCGGGTCGGGAGTGG - Intergenic
1203477211 Un_GL000220v1:153540-153562 CTACCTCCCCGGGTCGGGAGTGG - Intergenic
1192177353 X:68894392-68894414 TGCCCTCTCCGGGTCAGGCCTGG - Intergenic
1200397288 X:155998703-155998725 CAGCCTCTGCAGGTGGGGCGGGG + Intronic
1202372089 Y:24205521-24205543 CGGCCTCACGGGGCAGGGCGAGG - Intergenic
1202498696 Y:25464595-25464617 CGGCCTCACGGGGCAGGGCGAGG + Intergenic