ID: 1160024796

View in Genome Browser
Species Human (GRCh38)
Location 18:75208806-75208828
Sequence CGGGGCGAGAACGGGGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160024796 Original CRISPR CGGGGCGAGAACGGGGGCGT GGG Intronic
900119147 1:1041117-1041139 CGGGGCGGGAGCGGGGGCGGGGG + Intronic
900184040 1:1324772-1324794 CGGGGCGAGGGCGGGGCGGTGGG + Exonic
904710628 1:32427207-32427229 CGGGGCGAGAAGGGAGGCTTGGG - Intergenic
904837727 1:33349815-33349837 CGGGGCGGGAGCGCGGGCGGCGG + Intronic
905339037 1:37265804-37265826 CGGGGCAGGAAAGGGGGCATTGG + Intergenic
907296553 1:53459704-53459726 CGGGACGGGGACGGGGGCGGGGG - Exonic
915439248 1:155934289-155934311 CGGAGCGAGCACTGGGGCGCAGG - Intronic
918045586 1:180939110-180939132 TGGGGGGAGAAGGGGGGAGTGGG + Intronic
922116324 1:222617955-222617977 GGGGGCGGGGACGGGGGCGGGGG - Intergenic
922116357 1:222618010-222618032 CGGGGCGGGGACGGGGGGGCTGG - Intergenic
1065590347 10:27256752-27256774 CGGGGCGGGAGCGGGGGTGGGGG - Intergenic
1065590361 10:27256776-27256798 CGGGGCGGGAGCGGGGGTGGGGG - Intergenic
1065590375 10:27256800-27256822 CGGGGCGGGAGCGGGGGAGGGGG - Intergenic
1065590387 10:27256820-27256842 CGGGGCGGGAGCGGGGGGGGCGG - Intergenic
1069566080 10:69464380-69464402 TGGGGCGAGAACAGAGGGGTTGG + Intronic
1070891752 10:79946460-79946482 CGGGGCGAGAAGGGGGACCCAGG - Exonic
1072409080 10:95183895-95183917 CGGGGCGAGAACTGCGCCGTCGG + Intergenic
1073085106 10:100883287-100883309 AGGGGTGAGAAGGGGGGTGTTGG + Intergenic
1074867131 10:117551437-117551459 TGGGCCGGGAAGGGGGGCGTTGG - Intergenic
1076374058 10:129971900-129971922 CGGGGCGAGGGCGGCGGCGGCGG - Intergenic
1077090720 11:777202-777224 CGGGGCGGGGACGGGGGCGGGGG - Intronic
1077322822 11:1949882-1949904 AGGGGCGGGAACGGGGGTGGGGG + Intronic
1078180015 11:9003734-9003756 CGGGGCGAGAACGGCGGCGGGGG + Intronic
1081891722 11:46548318-46548340 GGGGGCGAGAACGGGGTGCTCGG - Exonic
1081981707 11:47270497-47270519 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1083614193 11:64018353-64018375 AGGGGCCAGAACGGGGGCCCAGG - Intronic
1202805840 11_KI270721v1_random:5195-5217 AGGGGCGGGAACGGGGGTGGGGG + Intergenic
1096094432 12:48925146-48925168 AGGGGCGAGAACGGGATCTTTGG - Intronic
1098426020 12:70366396-70366418 CGGGGAGAGTGCGGGGGCGGAGG + Exonic
1099413361 12:82358842-82358864 CGGGGCGGGAAGGGAGGCGGAGG + Intronic
1102151024 12:110689189-110689211 GGGGGCGGGGACGGGGGCGGGGG - Intronic
1102278156 12:111598704-111598726 CGGGGCGGGGACGGCGGCGCGGG + Intronic
1102574079 12:113844883-113844905 CGGGGCCAGAACCTGGGCTTTGG - Intronic
1102645473 12:114400883-114400905 CGGCTGGAGAACGGGGGCGGGGG + Intronic
1103906978 12:124332819-124332841 CTGGGCCAGACCGGGGGCGATGG - Intronic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1105409563 13:20160816-20160838 CGGGGCGGGGACGGGCGGGTCGG - Intronic
1105412694 13:20184641-20184663 CAGGGCGAGAAAGGGGGAGATGG - Intergenic
1105502888 13:20988343-20988365 CGGGGCGGGGGCGGGGGCGGGGG + Exonic
1107108686 13:36673738-36673760 CGGGGGGAGGAGGGGGGAGTGGG - Intergenic
1108603196 13:52012081-52012103 TGGGCCGGGAACGGGGGCGCAGG + Intergenic
1113724361 13:112587634-112587656 CGGGGCGAGAACGCCGGGGCGGG - Intronic
1116861792 14:50001333-50001355 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1119003980 14:70907798-70907820 CGGGGCGGGGACGGCGGCGGCGG + Exonic
1122162182 14:99793009-99793031 CCGGGAGAGAGCGGGCGCGTGGG - Intronic
1122719899 14:103716100-103716122 CTGGGAGAGAGCGGGGGCGGGGG - Intronic
1123037985 14:105479072-105479094 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1124712946 15:32030401-32030423 GGGGGCGGGGACGGGGGCGGGGG + Intergenic
1127117459 15:55742690-55742712 CAGGGCGAGAGCGGGGGCCGGGG + Intronic
1129016639 15:72474560-72474582 CGGAGCGAGAGCCGGGGCCTCGG + Exonic
1129423991 15:75451706-75451728 CGGGGCGGGGTCGGGGGAGTGGG - Intronic
1131814850 15:96211692-96211714 CGGGGGGAGAACAGGTGAGTGGG - Intergenic
1131828750 15:96341152-96341174 GGGGGCGAGGGCGGGGGCGGGGG + Intergenic
1132156128 15:99496345-99496367 CGGGGGGAGGACGAGGGTGTGGG + Intergenic
1132223900 15:100125932-100125954 GGGGGTGAGAAGGGGGTCGTGGG + Intronic
1132370566 15:101295078-101295100 CGGGGTGAGTCCGGGGGCGTGGG - Exonic
1132735899 16:1385778-1385800 CTGGGCGAGAGCCGGGGCGGGGG - Intronic
1133292723 16:4733846-4733868 CGGGGCGAGAGGGGGTGCCTGGG - Intronic
1136707667 16:32202515-32202537 TGGGGCGGGGACGGGGGCGGGGG + Intergenic
1136760243 16:32726895-32726917 TGGGGCGGGGACGGGGGCGGGGG - Intergenic
1136807861 16:33143491-33143513 TGGGGCGGGGACGGGGGCGGGGG + Intergenic
1137708003 16:50548586-50548608 CGGGGCGAGCGCGCGGGCGGGGG - Intronic
1138178597 16:54928376-54928398 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1141398737 16:83727834-83727856 CAGGGAGTGAACAGGGGCGTTGG + Intronic
1142352735 16:89587336-89587358 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1203062397 16_KI270728v1_random:987217-987239 TGGGGCGGGGACGGGGGCGGGGG - Intergenic
1142549995 17:732541-732563 CGGGACGGGGACGGGGGCGGAGG + Exonic
1143550475 17:7627509-7627531 CGCGGCCAGAGCGGGGTCGTAGG - Intronic
1146271364 17:31487955-31487977 CGGGGCGGGGGCGGGGGCGGAGG - Intronic
1146404959 17:32528862-32528884 CTGGGCCAGAACGAGGGCGTTGG - Intronic
1147650568 17:42059478-42059500 CTGGGTCAGAACGGGGGCGTGGG - Intronic
1148691229 17:49528131-49528153 AGGGGCTTGAAGGGGGGCGTGGG + Intergenic
1150675610 17:67244665-67244687 GGGGGCTGGAGCGGGGGCGTGGG - Intronic
1151919287 17:77141295-77141317 AGGGGCGAGCAGGGGGGCGGAGG - Intronic
1153688157 18:7567085-7567107 CGGGGCGAGGAGGTGGGCGGGGG + Exonic
1160024796 18:75208806-75208828 CGGGGCGAGAACGGGGGCGTGGG + Intronic
1160499609 18:79395541-79395563 CGGGGAGGGGATGGGGGCGTAGG - Intergenic
1160515660 18:79478092-79478114 GGGGGCAAGAACGGGGGCCTGGG - Intronic
1160869660 19:1271435-1271457 GGGGCCGAGGACGGGGCCGTGGG + Exonic
1161252038 19:3285666-3285688 CGGGGCGGGGAAGGGGGGGTGGG - Intronic
1161853358 19:6750365-6750387 CGGGGCGCTAGCGGGGGGGTCGG - Exonic
1162079259 19:8209050-8209072 CGGAGCGGGAACGGGGGCGGGGG + Intronic
1162079267 19:8209068-8209090 GGGGGCGAGAATGGGGGGGCGGG + Intronic
1163535538 19:17874302-17874324 CGGGGTCAGAACGGGAGCATGGG - Intronic
1165056850 19:33182822-33182844 CGGGGAGAGAAGGGTGGTGTTGG + Intronic
1166361270 19:42253929-42253951 CGGGGCGGGGACGGGGGAGGGGG - Intronic
1167042692 19:47032122-47032144 GGGGGAGAGACCTGGGGCGTGGG - Intronic
1167461397 19:49626295-49626317 GGGGGCGAGAACGGGGAGGAGGG - Exonic
1167862537 19:52297122-52297144 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1168679608 19:58305209-58305231 CGGGGCCGGAAGGGGAGCGTGGG - Intronic
926673043 2:15592916-15592938 GGGGGGGAGAATGGGGGGGTGGG + Intronic
926718487 2:15942233-15942255 CTGGGCGACAGCGGGGGCGTGGG - Exonic
929189314 2:39124487-39124509 GGCGGCGAGGACGGGGGCGGGGG + Intergenic
929303442 2:40332421-40332443 TGGGGGGAGGACGGGGGCGGGGG + Intronic
931241873 2:60461302-60461324 CGGGGCGCGGTCGTGGGCGTGGG - Exonic
931252934 2:60550003-60550025 CGAGGCGAGAGGGGGGGTGTCGG + Intronic
931649385 2:64454455-64454477 CGGGGCGGGGGCGGGGGCGCGGG - Exonic
934125895 2:88889758-88889780 CGGGGGGAGAGCGGGGGCTAGGG - Intergenic
934845832 2:97660805-97660827 CGGGGCTAGAGAGGGGGCCTAGG + Intronic
946247491 2:218396102-218396124 CGGGGCGGGATGGCGGGCGTCGG - Exonic
946250122 2:218406521-218406543 CGGGGCGGGAAGTGGGGCGGGGG - Intergenic
946422340 2:219571767-219571789 CGGGGCTAGAACCGGGGCTAGGG - Intronic
948801432 2:240435333-240435355 GGGGGCGGGGACGGGGGCGGAGG - Intergenic
948893052 2:240916379-240916401 GGGGGCGAGCAGGGGGGCGCAGG - Intergenic
1169082886 20:2807976-2807998 TGAGGGGAGAACGGGTGCGTGGG - Intergenic
1171113431 20:22504145-22504167 CGGGGAGAGTAAGGGGGCCTGGG - Intergenic
1172793318 20:37520970-37520992 CAGGGCGAGAATGGGGGTGCAGG - Intronic
1174133218 20:48360173-48360195 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1174379194 20:50145978-50146000 CGGGGCGAGAGCGGGATCTTAGG - Intronic
1176270154 20:64232125-64232147 CGGGGTGAGTACAGGGGCGAAGG - Intronic
1178534910 21:33403353-33403375 CGGGGCGGGGGCGGGGGCGCGGG + Exonic
1179437169 21:41369837-41369859 CGGGGCGGGAGCGGGGGCGGGGG - Intronic
1180110032 21:45643328-45643350 CGGGGCAAGAATCGGGGCGGGGG - Intergenic
1180637900 22:17275490-17275512 CGGGGCGGGGAGGGCGGCGTGGG - Intergenic
1182586341 22:31346154-31346176 CGGGGCGCGCACGGGGGCGGTGG + Exonic
1183486401 22:38089484-38089506 GGGGGCGCGAACGGCGGCGGGGG + Intronic
1184472125 22:44702130-44702152 CGGGGCGGGGAAGGGGGCGGGGG - Intronic
1184498765 22:44859644-44859666 CGGGAGGAGAACAGGGGTGTAGG - Intronic
1184500062 22:44865960-44865982 CAGGGGGAGGACAGGGGCGTAGG + Intergenic
953399563 3:42600929-42600951 AGGGGCGAGGGCGGGGGCGAGGG - Intronic
954305704 3:49724216-49724238 CGGGGCGAGGCCGGGGCCGTGGG - Intergenic
955356594 3:58237472-58237494 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
956064144 3:65379311-65379333 CGCGGGGAGAACGAGGGCTTCGG - Exonic
960914369 3:122681194-122681216 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
961612606 3:128152962-128152984 CGGGGGGAAGACGGGGGCGGGGG - Intronic
965268522 3:166581839-166581861 AGGGGCGAGAAGGGGGATGTGGG - Intergenic
967847919 3:194058547-194058569 CGGGGAGAGAAGAGGGGAGTGGG + Intergenic
968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG + Intergenic
968654257 4:1771810-1771832 AGGGGGGTGAACGGGGGCCTTGG + Intergenic
969669156 4:8580306-8580328 CGGGGCGGGGAAGGGGGCGGGGG - Intronic
979785676 4:124712789-124712811 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
981964290 4:150582034-150582056 CGGGGCGAGAAAGAGGTCGGAGG + Exonic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
986705444 5:10450922-10450944 CGGGGCGAGAAGGGAGAGGTTGG + Intronic
992529311 5:77639443-77639465 AGGGGCGAGGATGCGGGCGTGGG - Exonic
998018852 5:138753390-138753412 CGGGCCGGGGGCGGGGGCGTGGG + Intronic
1003291276 6:4780407-4780429 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1004262095 6:14117604-14117626 GGGGGCGGGGACGGGGGCGAAGG + Intronic
1005512126 6:26520862-26520884 CGGGACGGGGGCGGGGGCGTGGG - Intergenic
1006136939 6:31901390-31901412 CTGGGCAAGAATGGGGGCGAGGG - Intronic
1006933124 6:37699151-37699173 CGGGGCGGGATCGGAGGCGCGGG - Intronic
1010716288 6:79233897-79233919 CGGGGCGGGAGCGGTGGAGTTGG - Intronic
1013372629 6:109483462-109483484 CGGGGCGAGAATGCAGGCCTGGG + Intergenic
1016340900 6:143060787-143060809 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1019386443 7:759076-759098 CGGGAAGAGCACAGGGGCGTGGG - Intronic
1020011545 7:4808217-4808239 CGGGGAGAGAGAGGGGGCGGAGG - Intronic
1022207967 7:28180813-28180835 CGGGGGGAGGGCGGGGGCGGGGG + Intergenic
1028618886 7:92801953-92801975 AGGGGAGAGAACGGGGGGGAGGG - Intronic
1031361830 7:120857371-120857393 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1035476077 7:159144988-159145010 CGGGGCGGGGACAGGGGCGGGGG - Intergenic
1039791388 8:40878706-40878728 CGTGGCGAGAACGGTGCCATGGG - Intronic
1041355380 8:56993909-56993931 CGGGGCGAGGGCGAGGGCGAGGG + Intergenic
1049389434 8:142360419-142360441 CGGGGCCAGGACGGAGGGGTGGG + Intronic
1049710462 8:144060809-144060831 CAGGGCGAGGACGGAGGCGCGGG - Intronic
1053011827 9:34637883-34637905 CGGGGGGAGCACGGAGGAGTGGG + Intergenic
1056154153 9:83817837-83817859 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1058005149 9:99906588-99906610 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1060114422 9:120929049-120929071 CGGGGCGAGGAAGGGGGCCGGGG + Intronic
1060888833 9:127175540-127175562 CAGGGAGAGGTCGGGGGCGTGGG + Intronic
1061044990 9:128160168-128160190 CGGGGCCAGAACAGCGGCGGGGG + Intergenic
1186466124 X:9786024-9786046 GCGGGCGAGGACGGGGGCGGAGG - Intronic
1189310624 X:40014929-40014951 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1199772823 X:150984694-150984716 CGGGGCGGGACCGGGAGCGGGGG - Intronic
1200128464 X:153829204-153829226 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1200209725 X:154341903-154341925 CGGGGCGAGACCCAGGGCGCTGG - Intergenic
1200221127 X:154390189-154390211 CGGGGCGAGACCCAGGGCGCTGG + Intronic