ID: 1160027297

View in Genome Browser
Species Human (GRCh38)
Location 18:75229017-75229039
Sequence ATGCAACAAAACCCCTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160027297_1160027304 17 Left 1160027297 18:75229017-75229039 CCATTTCAGGGGTTTTGTTGCAT 0: 1
1: 1
2: 0
3: 21
4: 163
Right 1160027304 18:75229057-75229079 TCTCAAAGTGAGTGAGGGGTTGG 0: 1
1: 0
2: 1
3: 32
4: 201
1160027297_1160027303 13 Left 1160027297 18:75229017-75229039 CCATTTCAGGGGTTTTGTTGCAT 0: 1
1: 1
2: 0
3: 21
4: 163
Right 1160027303 18:75229053-75229075 GAGCTCTCAAAGTGAGTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 198
1160027297_1160027301 11 Left 1160027297 18:75229017-75229039 CCATTTCAGGGGTTTTGTTGCAT 0: 1
1: 1
2: 0
3: 21
4: 163
Right 1160027301 18:75229051-75229073 AGGAGCTCTCAAAGTGAGTGAGG 0: 1
1: 0
2: 1
3: 14
4: 207
1160027297_1160027300 -9 Left 1160027297 18:75229017-75229039 CCATTTCAGGGGTTTTGTTGCAT 0: 1
1: 1
2: 0
3: 21
4: 163
Right 1160027300 18:75229031-75229053 TTGTTGCATATGGTGGATAGAGG 0: 1
1: 0
2: 3
3: 86
4: 275
1160027297_1160027302 12 Left 1160027297 18:75229017-75229039 CCATTTCAGGGGTTTTGTTGCAT 0: 1
1: 1
2: 0
3: 21
4: 163
Right 1160027302 18:75229052-75229074 GGAGCTCTCAAAGTGAGTGAGGG 0: 1
1: 0
2: 1
3: 19
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160027297 Original CRISPR ATGCAACAAAACCCCTGAAA TGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
903337013 1:22631531-22631553 TTGCAACACAACCCTTGAATGGG + Intergenic
903771289 1:25766044-25766066 AGGCAGCAGAACCCATGAAAAGG + Intronic
905479341 1:38250352-38250374 GAGCCACAACACCCCTGAAATGG - Intergenic
907102729 1:51851440-51851462 ATGAAACAAAACCCTGGACAAGG - Intronic
908855167 1:68418420-68418442 AAGCAAAAAAACCTCTGTAATGG + Intergenic
910140875 1:84026303-84026325 ATGCCACAAAACCACTTCAATGG + Intergenic
910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG + Intronic
911164642 1:94713842-94713864 ATGAAGCAACACCCCTGAACTGG - Intergenic
911345113 1:96687623-96687645 ACTCAAGAAAACCCTTGAAAAGG + Intergenic
918786899 1:188774984-188775006 ATGCAACAAACCTCCTGATATGG + Intergenic
920025813 1:202994757-202994779 ATGCAACAAAAGCCATGTAAAGG + Intergenic
920072102 1:203309396-203309418 AAACAACAAAACCCCTGAGCTGG + Exonic
922056115 1:222043915-222043937 ATGAGACAAAACCCCCAAAATGG - Intergenic
922430111 1:225543067-225543089 ATGCAGCAATAACCCTGCAATGG - Intronic
923007215 1:230060058-230060080 ATGCAATAAAGCCCCTGTAGTGG - Intronic
1063076765 10:2724442-2724464 ATGAAAAAAATCCCCTGAACTGG - Intergenic
1065886255 10:30080103-30080125 ATTCAACAAAACCACTGGACAGG - Intronic
1066240618 10:33531089-33531111 CTGCAACAAAACCTCTGAGGAGG - Intergenic
1068057710 10:52031949-52031971 ATACAACTAAGGCCCTGAAATGG + Intronic
1070626117 10:78052619-78052641 ATCCAACATAACCCCTAGAAGGG - Intronic
1075177329 10:120177707-120177729 ATGCAAGAATATCCCTAAAATGG + Intergenic
1075219975 10:120576390-120576412 CTGCAACAAACCCCCGGAAAAGG - Intronic
1076174224 10:128354586-128354608 CTGCCACAAAATCCCTGAGATGG - Intergenic
1076198209 10:128536067-128536089 AGGCAAAAGAAGCCCTGAAAAGG - Intergenic
1076255364 10:129019371-129019393 CTTCAACATAACACCTGAAATGG + Intergenic
1076711544 10:132338471-132338493 ATGCAAGGAAACTCCTGGAAGGG - Intronic
1077804621 11:5578146-5578168 ATGAAACAAAGTCCCTGAATTGG + Intronic
1078423862 11:11233814-11233836 ATCCAAACAGACCCCTGAAATGG - Intergenic
1080957972 11:37123660-37123682 ATGCAACAAAAGCCCATAAAGGG - Intergenic
1082630697 11:55538524-55538546 AAACAACAAAATCCCTGAACTGG - Intergenic
1085352220 11:75805689-75805711 ATGAAACAAAACTCCCTAAACGG - Intergenic
1087720131 11:101654100-101654122 ATGCAGCAAAAGCAGTGAAAGGG + Intronic
1088356102 11:108945226-108945248 ATCCAAGAAGACCCATGAAAAGG - Intergenic
1090604856 11:128411098-128411120 ATGGAACAAAAGGCCTGATAGGG - Intergenic
1092434665 12:8437715-8437737 AGACAACAAGATCCCTGAAATGG + Intergenic
1093146214 12:15569835-15569857 ACACTACAAATCCCCTGAAAGGG - Intronic
1093746200 12:22743507-22743529 ATGCAACAACAGCATTGAAATGG - Intergenic
1097160929 12:57046326-57046348 TGGCAATAAAACCCCAGAAAAGG + Intronic
1098708833 12:73727686-73727708 AGGCATCAAAACCTATGAAATGG + Intergenic
1099620927 12:85002249-85002271 ATGCAACAGAAACACTGAGATGG + Intergenic
1099697827 12:86044031-86044053 AAGCAACAAAACCCATTCAAAGG - Intronic
1101210851 12:102534090-102534112 ATCTAACAAAACACTTGAAATGG - Intergenic
1106781016 13:33059078-33059100 ATGCAACAAAACCTCTGCTATGG + Intronic
1108670840 13:52686577-52686599 ATGCAAAAAAGCCCATGTAAGGG + Intronic
1109564959 13:64100620-64100642 ATGCAACATAACTCCTGACATGG + Intergenic
1109768006 13:66930438-66930460 ATGCAAACAAAGCTCTGAAATGG - Intronic
1109946668 13:69443263-69443285 AGGCAACAAAATACATGAAATGG - Intergenic
1113942748 13:114026883-114026905 AAGCACCAAAATCCATGAAAAGG - Intronic
1114703093 14:24698233-24698255 ATGGACCAAAAGGCCTGAAACGG - Intergenic
1115523757 14:34258908-34258930 AGGCAACAGAAACCCTGAAATGG + Intronic
1117608437 14:57456414-57456436 ATGAAAATAAATCCCTGAAAAGG - Intergenic
1117764377 14:59065080-59065102 GTGCAACAAAACGCATGAAGAGG - Intergenic
1121156607 14:91691021-91691043 ATGGAACAAAATCCCCCAAAAGG + Intronic
1122776831 14:104120780-104120802 CTGTAACAAAACCTCTGAGATGG + Intergenic
1124070353 15:26386902-26386924 ATTCAAGAAAACAGCTGAAATGG - Intergenic
1124897751 15:33792794-33792816 ATGCAACAAAACCCACAAATAGG - Intronic
1125574487 15:40746017-40746039 ATGCAAACTACCCCCTGAAAAGG + Intronic
1126031607 15:44504816-44504838 ATGCAACTATGACCCTGAAATGG - Intronic
1127567672 15:60208733-60208755 ATGCAACCATTCCCCTGAAATGG - Intergenic
1128243372 15:66116589-66116611 ATGCAACAAGGACCCTGTAAGGG + Intronic
1129374167 15:75117060-75117082 ATGCAACTAAAGCTCTTAAAAGG - Intronic
1129528195 15:76236986-76237008 ATGGAACAAAACACCAAAAAAGG + Intronic
1131007529 15:88990601-88990623 ATGCAACAAGACATCTCAAAAGG + Intergenic
1131074746 15:89487975-89487997 ATGCAACATAAGCGCTGAGAGGG - Intronic
1132041669 15:98529796-98529818 AAACAATAAAACCTCTGAAAAGG + Intergenic
1135707381 16:24686416-24686438 AAGAAACAAAACCCTTGGAAAGG - Intergenic
1136602593 16:31304476-31304498 ATGCAACAAAACCAATAAATGGG - Intronic
1138480026 16:57296460-57296482 ATCCTACAAAACCCCTGAACAGG - Intergenic
1138741017 16:59310229-59310251 ATGGAACAAAACTTCTGAAGTGG + Intergenic
1139643342 16:68309544-68309566 ATGCAGCAAAACTACAGAAATGG - Intronic
1141416908 16:83882779-83882801 TTTCATCAAAGCCCCTGAAAGGG + Intergenic
1143696554 17:8624629-8624651 CTTCAACAAAATCCCTGAAATGG + Intronic
1143838346 17:9710863-9710885 ATGAAACAAATCACGTGAAAGGG - Intronic
1144213967 17:13038438-13038460 ATGCCACATGACACCTGAAAGGG - Intergenic
1145926160 17:28648467-28648489 ATGCAAGAAAAGCTCTTAAAAGG + Exonic
1146823606 17:36004185-36004207 ATGCAAAAAAAAACCTGAAAAGG + Intergenic
1148943053 17:51231993-51232015 TTAGACCAAAACCCCTGAAAGGG + Intronic
1153557201 18:6327574-6327596 ATGTAACAACACTGCTGAAAAGG + Intronic
1158300171 18:56043215-56043237 CAGCAACACAACCCCAGAAATGG + Intergenic
1159084115 18:63768540-63768562 ATGAAACAAACTCACTGAAAGGG - Intronic
1159540607 18:69770062-69770084 AACCACAAAAACCCCTGAAAGGG + Intronic
1159572582 18:70135374-70135396 ATGCAACATAAACCCAGATAAGG + Intronic
1160027297 18:75229017-75229039 ATGCAACAAAACCCCTGAAATGG - Intronic
1165277477 19:34767501-34767523 CTGCAATGAAACCCCAGAAAGGG + Intronic
1167829149 19:52004268-52004290 ATGTAAAAAGACCTCTGAAAAGG - Intronic
925062929 2:907210-907232 AGGCAACAAATTCCCTCAAAGGG + Intergenic
926874313 2:17457879-17457901 GTACAACAAAACACATGAAATGG - Intergenic
927037764 2:19198202-19198224 ATGCAATAAGACCCCAAAAAAGG + Intergenic
931813845 2:65880842-65880864 ATGGAGCAAAGCCCCTGAGATGG + Intergenic
935085841 2:99844106-99844128 ATACAAAAAAAGACCTGAAAGGG + Intronic
935279383 2:101504592-101504614 ATGCATCAAAATCACTGCAAGGG - Intergenic
936456764 2:112681220-112681242 CAGCAATAAAACCCCAGAAATGG - Intergenic
937478711 2:122238015-122238037 ATGCAAGAAAACAAATGAAAAGG - Intergenic
938028954 2:127975307-127975329 ATGCAACAAAAGACCAAAAAGGG + Intronic
939728745 2:145755348-145755370 AAGAAATAAAACCCCTGAAATGG - Intergenic
942039561 2:172045346-172045368 ATGCTCCAAAACCACTAAAAAGG + Intronic
944086839 2:195858273-195858295 ATGCAAAAACACCTTTGAAATGG - Intronic
944102075 2:196037412-196037434 AATCTAAAAAACCCCTGAAAAGG + Intronic
945406331 2:209453489-209453511 ATGCAACATAACGACTTAAAAGG + Intronic
945638633 2:212393367-212393389 ATGAATCAAAACCACTGAACAGG + Intronic
946293364 2:218763208-218763230 ATGAAAAAAAAACCCAGAAATGG - Intergenic
946441299 2:219698895-219698917 AGGAAACAAAACCCCGGAAAGGG + Intergenic
946559069 2:220892275-220892297 AGGCAAACAAACCCCAGAAAAGG - Intergenic
947024907 2:225726428-225726450 AAGTAACAACACCACTGAAAGGG + Intergenic
947451242 2:230211154-230211176 ATGCCACAAAGCGCCTGAAAGGG - Intronic
947851943 2:233295269-233295291 CTTCATCACAACCCCTGAAACGG - Exonic
1170347082 20:15399247-15399269 ATGAAACCAAACCTCTGAATTGG - Intronic
1170609727 20:17902657-17902679 ATGCATCAGAACCCCTGGCAGGG - Intergenic
1171382703 20:24745646-24745668 ATGCCTCAAATCCCCAGAAAGGG + Intergenic
1171939649 20:31313557-31313579 ATGGAAGAATCCCCCTGAAACGG + Intergenic
1173713331 20:45179488-45179510 ATGTAACCAAACCCCTGAATGGG + Intergenic
1175677582 20:60959993-60960015 ATGCAAGAAAACCCTTCAGAGGG - Intergenic
1179944510 21:44662483-44662505 ATGCAACAAAAAAACTGAGAAGG + Intronic
1183135412 22:35882363-35882385 TTGCAACCACACCACTGAAAGGG - Intronic
950371034 3:12530733-12530755 ATGCTACAAGTCCCCTAAAATGG - Intronic
951804512 3:26629836-26629858 CTGCTACAAAACCTGTGAAAGGG + Intronic
953752889 3:45622966-45622988 ATGCATCAAAAACCTTTAAAAGG - Intronic
955153203 3:56389559-56389581 CTGCAGCACAACTCCTGAAATGG - Intronic
955290276 3:57685858-57685880 ATCCTATAAATCCCCTGAAACGG + Intronic
955701943 3:61690331-61690353 CTGCAACAAACACCCAGAAAGGG - Intronic
959171675 3:102851575-102851597 ATGTTGCAGAACCCCTGAAAGGG - Intergenic
959318353 3:104838419-104838441 ATGCTATAAGCCCCCTGAAAAGG + Intergenic
959373934 3:105564289-105564311 ATGGCACAAAATACCTGAAAGGG - Intronic
967668321 3:192201316-192201338 ATGGAACACAACAACTGAAATGG + Intronic
969258467 4:6019154-6019176 GAGCAACAAGACCCCAGAAAAGG + Intergenic
971942749 4:33236895-33236917 ATACAACAAAAATCATGAAAAGG - Intergenic
974603919 4:64123482-64123504 ATGCAAAAACAGCCTTGAAAAGG + Intergenic
975179191 4:71323982-71324004 CTGCAAAAAAACACCTGGAAGGG - Intronic
980608805 4:135129256-135129278 ATGCAACATAAAACCTTAAATGG - Intergenic
981509011 4:145534458-145534480 ATGCAAACAAAACACTGAAAAGG + Intronic
981726183 4:147849849-147849871 ATGCAGCAGAACCCATAAAATGG - Intronic
982052922 4:151521384-151521406 ATGCAAGAAAACCTCTTAAAAGG - Intronic
984074761 4:175162016-175162038 AGGAAACAAAACCTCTGCAATGG - Intergenic
985124690 4:186681706-186681728 ATGCATCAATACCGCTGAAGTGG + Intronic
986056530 5:4142903-4142925 AAGCAACAAAAACCGGGAAAGGG + Intergenic
987227237 5:15855330-15855352 ATGCAGAAAAACGTCTGAAAGGG - Intronic
987947720 5:24634095-24634117 ATTCAAAAAAACACATGAAATGG + Intronic
989479801 5:41917329-41917351 AAACAACAAAACCCATGAAATGG + Exonic
999639825 5:153661342-153661364 AGGCAACAAAAACTCAGAAAAGG - Intronic
1000532483 5:162440768-162440790 ATGCAACCAAACTCCCTAAAAGG + Intergenic
1001221151 5:169902135-169902157 ATACCACAAAAACACTGAAAAGG + Intronic
1005314031 6:24587225-24587247 AGGCAACAAGATCCATGAAAAGG - Intronic
1006310189 6:33251923-33251945 ATGCCACTAAACCCCCAAAAGGG + Exonic
1014293278 6:119586391-119586413 ATGAAAGAAAATCTCTGAAAGGG - Intergenic
1014344171 6:120246627-120246649 ATTCAACAATACCCCTTAGATGG + Intergenic
1015702362 6:136050541-136050563 AGGCAGCAGAACTCCTGAAAAGG - Intronic
1023369345 7:39497494-39497516 ATGCTACAAAACTCCTAAGAAGG - Intergenic
1023652902 7:42389651-42389673 AAGAAACAAAAGCCATGAAAAGG + Intergenic
1024173261 7:46811593-46811615 ATTCAAAAAACCCACTGAAAGGG + Intergenic
1027612710 7:80381850-80381872 AAGCAGCAAAAGCCATGAAAAGG - Intronic
1032299430 7:130672979-130673001 ATGCAACAAAACCTGTCAGAGGG + Intronic
1033009224 7:137601817-137601839 ATGCAACAAAAGACCTGCATTGG - Intronic
1033093896 7:138412990-138413012 ATGCAAGAAAACTCATGCAAAGG + Intergenic
1034480728 7:151318645-151318667 ATGAAACTAAATCCCTGAAAGGG + Intergenic
1036177556 8:6553635-6553657 CAGAAACAAAATCCCTGAAATGG + Intronic
1037130565 8:15403821-15403843 CTGCAACAAAACAGCTGAACAGG + Intergenic
1037656879 8:20891740-20891762 AGGCAAAATAACCCCTGAGAGGG - Intergenic
1038493180 8:27984171-27984193 ATGCAGCAAAACCCTTCTAAAGG + Intronic
1040535842 8:48309191-48309213 ATGCAAGAGAGCCCCTGAAATGG + Intergenic
1041350627 8:56944741-56944763 ATGCAAGTAAACCCCTAAATTGG + Intergenic
1041380680 8:57251584-57251606 ATGCAAGAAATCCGATGAAAAGG - Intergenic
1043426659 8:80154817-80154839 ATAGAAAAAAAACCCTGAAATGG - Intronic
1043783356 8:84364974-84364996 ATGCAACAAAATGCATGGAAGGG - Intronic
1043834480 8:85031496-85031518 CTTCAACAAGAGCCCTGAAATGG - Intergenic
1044212069 8:89561756-89561778 GCACAACAAAACCCATGAAATGG - Intergenic
1045450173 8:102316828-102316850 CTGCCACAAAACACCTGCAAAGG + Intronic
1045813097 8:106246949-106246971 TTGCCACAAAAGCGCTGAAAAGG + Intergenic
1045935497 8:107674158-107674180 TTGCAACAAAACCACCGAAAAGG + Intergenic
1051135737 9:13918326-13918348 ATGCAACAAAACCCTATAAATGG - Intergenic
1051621994 9:19060275-19060297 ATGCAACAAAACCCCTGATAAGG + Intronic
1055036066 9:71819898-71819920 CTGCAACCAAACACGTGAAATGG + Intergenic
1056150096 9:83777428-83777450 ATCAAATAAAACTCCTGAAAAGG + Intronic
1056468934 9:86886419-86886441 CTACAACAAAACACCAGAAACGG - Intergenic
1061201934 9:129143041-129143063 TTGCATCAAAATCCCTGAAGCGG - Intronic
1062353488 9:136151051-136151073 GTGCATCAAATCCCCAGAAAAGG + Intergenic
1186650264 X:11552018-11552040 ATGAAACAAAAACCTAGAAAAGG + Intronic
1187058067 X:15759689-15759711 GGGCAACAAAAGCCCTGCAAAGG - Intronic
1188929227 X:36085820-36085842 ATGCATCAAAATCACTGAGAGGG + Intronic
1189846351 X:45142100-45142122 ATACCACAAAATCCCTCAAAAGG - Intergenic
1192066966 X:67895702-67895724 AACCAACAGAGCCCCTGAAATGG + Intergenic
1192733279 X:73822678-73822700 ATGCAACAAAAACACAAAAATGG - Intergenic
1196745545 X:119068777-119068799 ATGCCACAGAAATCCTGAAAGGG + Intergenic
1196934564 X:120716741-120716763 ATGCCAAAAAAAACCTGAAATGG - Intergenic
1196975151 X:121151117-121151139 ATTCAAGAAAAGCCCTTAAAAGG - Intergenic
1201937204 Y:19421626-19421648 GAGCTTCAAAACCCCTGAAAAGG + Intergenic