ID: 1160030044

View in Genome Browser
Species Human (GRCh38)
Location 18:75250036-75250058
Sequence CCCCACCTACTGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160030044_1160030060 25 Left 1160030044 18:75250036-75250058 CCTTCCTCCTGCAGTAGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 274
Right 1160030060 18:75250084-75250106 CCTCATCCCTGCAGTTGGTGGGG 0: 1
1: 0
2: 3
3: 33
4: 275
1160030044_1160030056 20 Left 1160030044 18:75250036-75250058 CCTTCCTCCTGCAGTAGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 274
Right 1160030056 18:75250079-75250101 TCTTGCCTCATCCCTGCAGTTGG 0: 1
1: 0
2: 1
3: 30
4: 284
1160030044_1160030057 23 Left 1160030044 18:75250036-75250058 CCTTCCTCCTGCAGTAGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 274
Right 1160030057 18:75250082-75250104 TGCCTCATCCCTGCAGTTGGTGG 0: 1
1: 1
2: 1
3: 34
4: 446
1160030044_1160030061 26 Left 1160030044 18:75250036-75250058 CCTTCCTCCTGCAGTAGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 274
Right 1160030061 18:75250085-75250107 CTCATCCCTGCAGTTGGTGGGGG 0: 1
1: 1
2: 7
3: 47
4: 245
1160030044_1160030058 24 Left 1160030044 18:75250036-75250058 CCTTCCTCCTGCAGTAGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 274
Right 1160030058 18:75250083-75250105 GCCTCATCCCTGCAGTTGGTGGG 0: 1
1: 1
2: 1
3: 25
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160030044 Original CRISPR CCCCACCTACTGCAGGAGGA AGG (reversed) Intronic
900991571 1:6100543-6100565 CCCCACCCACTGTTGGAAGAGGG + Exonic
902596025 1:17509936-17509958 CCCCTCCTACTGCAAGAGATGGG - Intergenic
902620595 1:17648537-17648559 CCTCCCCTACAGCAAGAGGAAGG - Exonic
902656857 1:17875047-17875069 CCCCACAGCCAGCAGGAGGAAGG - Intergenic
902987101 1:20161585-20161607 GCCCACCTCCTGGAGGATGAGGG - Intronic
903034908 1:20486820-20486842 CCCCGCCTCCCGCAGGAGAAGGG + Intergenic
904263006 1:29301175-29301197 CCTCACCCAGAGCAGGAGGAGGG + Intronic
904466686 1:30712306-30712328 CCCCACATAGGGCTGGAGGAAGG + Exonic
907444364 1:54498589-54498611 CCCCACCTAGACCAGCAGGAAGG + Intergenic
908741863 1:67337075-67337097 CACTGACTACTGCAGGAGGAGGG + Intronic
909674672 1:78225967-78225989 CCCCACGTACTGCTTGAGAATGG + Intergenic
911359807 1:96862636-96862658 CCTCACCCACTCCAGGAGCATGG - Intergenic
913190453 1:116408836-116408858 CACTCCCTACTGAAGGAGGAGGG + Intronic
913534461 1:119758060-119758082 TCCCACCCACTGCAGTAGAAAGG + Intronic
914513720 1:148355701-148355723 TCCCAGCTACTTGAGGAGGACGG - Intergenic
917079081 1:171237766-171237788 CCCCACCCATTGAAGAAGGATGG - Intergenic
917352251 1:174090469-174090491 CCACACCTAATGCAGGAAGATGG - Intergenic
917835759 1:178940430-178940452 TCCTTCCTACTCCAGGAGGAAGG + Intergenic
917868573 1:179221845-179221867 CCCAACCCACTGCAGTAGGGAGG - Intronic
918343786 1:183589036-183589058 CCCCACCTCTGGCTGGAGGAAGG - Intronic
919424848 1:197417356-197417378 CCCCTCCTACTGCAGGTTAAGGG + Intronic
919914758 1:202132565-202132587 CCCCTCCCACTGCAGGAAAAAGG - Exonic
920344219 1:205295489-205295511 TCCCAGCTACTGGAGGAGCAGGG + Intergenic
920674280 1:208028674-208028696 CACCCCCTGCTGCGGGAGGAAGG - Intronic
921949161 1:220911142-220911164 CCCACCCTACTGTAAGAGGAAGG + Intergenic
922214102 1:223506889-223506911 CCCCACCTGCTGCAGTACCAGGG + Intergenic
1063200418 10:3781722-3781744 CTCCCCCGACGGCAGGAGGAGGG - Exonic
1063388921 10:5635882-5635904 GCCCACCTTCTGCAGGTGGGAGG - Intergenic
1068764497 10:60748063-60748085 GCCCACCTACTGCAGGATCGTGG - Intergenic
1069830277 10:71278723-71278745 CCCCACCTACAGCGGAGGGAGGG - Intronic
1070789816 10:79182346-79182368 CCCCACCTTCTCCTGGAGGTGGG - Intronic
1070795117 10:79211776-79211798 GCCCGACTACTGGAGGAGGAAGG - Intronic
1072361547 10:94664199-94664221 CCCCACCCAGTGAAGAAGGATGG + Intergenic
1075440243 10:122474468-122474490 GCCCCCCTGGTGCAGGAGGAGGG - Intronic
1075571844 10:123551939-123551961 CCCCACTTCCTGTAGGAGGTAGG + Intergenic
1077497089 11:2891616-2891638 CCTCCTCCACTGCAGGAGGAGGG + Intronic
1077517821 11:3012510-3012532 ACCCACCTGCTGCAGTAGAAAGG - Intronic
1077863666 11:6205388-6205410 CTTCCCCTAATGCAGGAGGATGG + Intergenic
1077995196 11:7446767-7446789 ACCCACATTCTCCAGGAGGAGGG - Intronic
1078351101 11:10594187-10594209 CCCCATCTTCTGCAGCAGGAGGG + Exonic
1078469240 11:11573824-11573846 CCCCGCCTTCTGCAGTGGGAAGG - Intronic
1078549930 11:12272972-12272994 CCCCACCAACTCCAGCAGGAAGG + Intergenic
1079008780 11:16811546-16811568 CCCCACAGGCTGCAGGAGGATGG + Intronic
1080700304 11:34638792-34638814 CCCCATCTTCTGCTGGAGGCAGG - Intronic
1080750078 11:35143010-35143032 CCCCACCCACTGCAGGGGGTGGG - Intronic
1081659786 11:44880963-44880985 CCACGCCTGCTACAGGAGGACGG - Intronic
1083187693 11:61027028-61027050 ACCCACCAAGTGCAGAAGGAGGG + Intergenic
1084616063 11:70236677-70236699 CCCCACCTCCTCCAGGAGAGAGG + Intergenic
1087239728 11:95761436-95761458 CCCCACCTACTGCAAATGGCTGG - Intergenic
1089140028 11:116277159-116277181 CCGCTCCTACCGCAGGAGTAGGG + Intergenic
1090839591 11:130476517-130476539 CTCCATGTACTGCAGAAGGATGG + Exonic
1091078393 11:132642702-132642724 CCCCACCTTCTTCATGAGGTTGG - Intronic
1091788218 12:3256014-3256036 CTCCACCTACTGCAAGAGGCGGG - Intronic
1092306484 12:7306314-7306336 GCCCACCTACTGCTCGGGGAAGG + Intronic
1095511436 12:42955123-42955145 CCCCACCTTCTTAAGGAAGAAGG - Intergenic
1096338395 12:50775504-50775526 TCCCAGATACTGCAGGAGGTGGG - Intronic
1096614035 12:52821674-52821696 CCCATCCTACTGCAGGACCAAGG + Exonic
1097020996 12:56020838-56020860 TCCCTCCTCCTCCAGGAGGAAGG - Intronic
1097169641 12:57105552-57105574 TCCCAGCTACAGCAGGAGGTAGG - Exonic
1102350813 12:112190793-112190815 CTCCACCACCTGCAGGAGGACGG + Exonic
1102510852 12:113414467-113414489 CTGCACCTGCTGCAGCAGGAAGG + Intronic
1102948126 12:117008214-117008236 CTCCAACTTCTGCAGCAGGAAGG - Intronic
1103763583 12:123267377-123267399 CACCACCAACTGTAGCAGGATGG + Intronic
1104256385 12:127143044-127143066 CCCCGCCCACTGAAGAAGGATGG + Intergenic
1104523079 12:129493706-129493728 CCTCACCACATGCAGGAGGAAGG + Intronic
1104858840 12:131914362-131914384 CCGCACCTGCTGCTGGAGAACGG - Exonic
1105443089 13:20431389-20431411 GCCCAGCTTCTGCAGGGGGAAGG - Intronic
1107666971 13:42700415-42700437 CCCCACCCCCAGCATGAGGAAGG + Intergenic
1113561661 13:111286478-111286500 CCCCAGCTCCTGGATGAGGAAGG - Intronic
1114758076 14:25282606-25282628 ACCCACCTGCTTCAGGATGATGG + Intergenic
1118277146 14:64395414-64395436 CCCCACCCACTCAAGGATGAGGG - Intronic
1118873910 14:69766951-69766973 CCCCACCCACCGCGGGAGCAGGG + Exonic
1119662280 14:76460536-76460558 CCCCACCTCCTGAGGGAGCAGGG - Intronic
1120679718 14:87465921-87465943 CCCCACCTAATCCATAAGGATGG + Intergenic
1121774606 14:96582545-96582567 CTTCACCTCCTGCAGGATGAAGG + Intergenic
1122019123 14:98821682-98821704 CCCCAGTTTCTGCATGAGGATGG - Intergenic
1122718898 14:103711427-103711449 ACTCAACTGCTGCAGGAGGATGG - Intronic
1124500707 15:30224900-30224922 CTGCACCTTGTGCAGGAGGATGG - Intergenic
1124742863 15:32313767-32313789 CTGCACCTTGTGCAGGAGGATGG + Intergenic
1126374809 15:47986793-47986815 CACCACCTACTGCAATAGGTCGG - Intergenic
1127273577 15:57422974-57422996 CCCAAACTACTCCAGGTGGAGGG - Intronic
1127298011 15:57626999-57627021 CCCCCCCGACCACAGGAGGAAGG - Intronic
1127369898 15:58330020-58330042 CCCAACCTTGTGCACGAGGAAGG - Intronic
1128216016 15:65934652-65934674 CCCCACCCGCTGAAGGGGGAAGG + Intronic
1128528005 15:68425546-68425568 CCCCACCTCCTCCAGGCAGAAGG - Intronic
1129224170 15:74156888-74156910 CACCAACTCCTGCAGGAGCAAGG - Intergenic
1129423810 15:75451070-75451092 CCCCGCCCACCCCAGGAGGAGGG + Intronic
1131535252 15:93232088-93232110 CCGCCCCCACTGCAGGAGGCTGG + Intergenic
1132571556 16:646592-646614 CCGCACCTACAGCCGGAGGTGGG - Intronic
1132806126 16:1775969-1775991 CCCCGCCTTCTGCAGCAGGTGGG + Exonic
1132806127 16:1775970-1775992 GCCCACCTGCTGCAGAAGGCGGG - Exonic
1132989073 16:2783823-2783845 CCCCACATACTGCAAGAGGCTGG - Intergenic
1133175296 16:4010012-4010034 CCCCACATACTGAGAGAGGAGGG + Intronic
1133336559 16:5010439-5010461 CCCCACATTCTCCAGGAGGCTGG + Intronic
1133773645 16:8882259-8882281 CCTCACTTCCTGCAGGAGGAGGG - Intergenic
1133972588 16:10578545-10578567 CCCCACCTCGGGCTGGAGGAGGG - Intronic
1137290740 16:47050366-47050388 CCCCACCTGCTGGGGGAGGGAGG - Intergenic
1138029623 16:53550116-53550138 CTCCATCTACAGCCGGAGGAAGG - Intergenic
1138445678 16:57061653-57061675 CCCCACCAAGCTCAGGAGGATGG - Exonic
1138453194 16:57105973-57105995 CCCCTCCTACCCCAGCAGGAGGG - Intronic
1142275358 16:89115705-89115727 TCCCACCCATTGCAGGGGGAAGG - Intronic
1142353528 16:89590711-89590733 CCCCACCTACTGAGAGAGGTAGG - Intronic
1203060551 16_KI270728v1_random:965258-965280 TCCCAGCTACCGCAGGAGGGAGG - Intergenic
1143634680 17:8157650-8157672 TTCCAGCTACTGCAGGAGAATGG + Intronic
1144366043 17:14545799-14545821 CCTCACCTACTGCAGATGGGAGG + Intergenic
1144775070 17:17781270-17781292 CCCCACCTCCTTCAGGAGGGAGG + Intronic
1145111301 17:20164275-20164297 TCCCAGCTACTTCAGGAGGCTGG - Intronic
1145224577 17:21117189-21117211 CCCCACCGCCTGCTGGAGGAGGG + Intergenic
1148624989 17:49062446-49062468 TCCCAGCTAGAGCAGGAGGATGG + Intergenic
1150221433 17:63497718-63497740 CCCCGGCTCCTGAAGGAGGATGG - Intronic
1151614804 17:75202738-75202760 CCCTAGCTACAGCAAGAGGAAGG - Intergenic
1151684523 17:75638973-75638995 GCCCACCCACTGCAGAAGGTCGG - Exonic
1152108258 17:78342888-78342910 CCCCGCCTCCTACAAGAGGATGG + Intergenic
1152122469 17:78427154-78427176 CCCCACCCACTGCAGGGTCAGGG + Intronic
1152238294 17:79149634-79149656 CCCCACACACTGCAGAAGGTTGG + Intronic
1152248069 17:79196286-79196308 CCCCACTTTCTGCTGGAGGAGGG - Intronic
1152329978 17:79667116-79667138 CCACCCCCACTGCATGAGGACGG + Intergenic
1152695405 17:81741504-81741526 CCTCCCCTTTTGCAGGAGGATGG + Intergenic
1152755331 17:82084798-82084820 CGCCACTTCCTGCTGGAGGAGGG - Exonic
1153125345 18:1784470-1784492 CCCCACCCACTGAGGAAGGAAGG - Intergenic
1155166743 18:23237916-23237938 CCCCGCCTGCTGTGGGAGGAGGG + Intronic
1157242775 18:46026768-46026790 TCCCAGCTACTGGGGGAGGATGG + Intronic
1157796513 18:50580133-50580155 CCCCACAGACTGAAGGAGGAAGG - Intronic
1158482660 18:57835693-57835715 CCCCAAGTTCAGCAGGAGGATGG - Intergenic
1158887388 18:61841017-61841039 TACCACCTACTGCAGGAGGCTGG + Intronic
1159596097 18:70384160-70384182 CCCCACATCATGCAGGAGGTAGG - Intergenic
1159794259 18:72822441-72822463 CCCCACGTCCTGCGGGGGGACGG - Intronic
1159942471 18:74418863-74418885 CCCCACCTCCTGCACCAGGCAGG - Intergenic
1159960895 18:74555232-74555254 ACCCTCCTGCAGCAGGAGGAAGG - Intronic
1160029866 18:75249379-75249401 CGCCACCTACTGCAGGGGTAGGG - Intronic
1160029950 18:75249690-75249712 CCCTACCTACTGCAGGAGTGAGG - Intronic
1160029962 18:75249739-75249761 CCCCACCTACTGCAGGGGTGAGG - Intronic
1160029977 18:75249784-75249806 CCCCACCTACTGCAGGTGTGAGG - Intronic
1160030044 18:75250036-75250058 CCCCACCTACTGCAGGAGGAAGG - Intronic
1160220007 18:76968272-76968294 CACCACCTCCTCCAGGTGGAGGG - Exonic
1160436290 18:78855201-78855223 CATCACCTACTGGAGAAGGAGGG + Intergenic
1160725356 19:615807-615829 CTGCACCTTGTGCAGGAGGATGG - Exonic
1163236925 19:16035362-16035384 CTCCACCTCCTGCAGGTTGAGGG + Intergenic
1163555208 19:17988185-17988207 CCCCAACAACTCCAGGAGGTAGG - Intronic
1163672841 19:18638490-18638512 CCACACCTACCCCAGGAGGCTGG - Intronic
1163839158 19:19595343-19595365 CCCCAAGTACTGCAGGCTGAGGG - Intronic
1163862974 19:19751926-19751948 CTCCACCTCCTGCAGGTCGAGGG - Intergenic
1165755050 19:38288171-38288193 CCCCATCTCCTCCTGGAGGATGG + Intronic
1165773264 19:38390284-38390306 CCCCACCTCCTGCAGGTACATGG + Exonic
1166256119 19:41606156-41606178 CCACACCTCCTGCTGGAGGAGGG - Intronic
1166528364 19:43527091-43527113 CCGCACCTGCCGCAGGAGGATGG + Exonic
1166695440 19:44848970-44848992 CCCCACGTAGTGGAGGGGGAGGG + Intronic
1167260503 19:48455311-48455333 CCCCACCTACTGGTGGGGGCTGG - Exonic
1167492854 19:49802042-49802064 CCCCGGCTTCTGCAGGAGCAGGG + Exonic
1167820861 19:51926742-51926764 CTCCACCTACAGCAGAGGGAAGG + Intronic
1168401104 19:56086842-56086864 CGCCCCCTACGGGAGGAGGATGG - Intergenic
926113330 2:10196272-10196294 CCCCACCAACTGCAGGCCCACGG + Intronic
926428519 2:12762548-12762570 ACCAACCTACTGCAGGAGCCTGG + Intergenic
927142092 2:20137484-20137506 TCCCACCTCCTCCAGGAAGAAGG + Intergenic
932347274 2:71003973-71003995 GCCCAACCACTGGAGGAGGAAGG + Intergenic
932432274 2:71683176-71683198 GCCCACCTGCTGCAGGAGGCAGG - Intronic
932826747 2:74948129-74948151 CCCCACCTAATGGGGAAGGATGG - Intergenic
937254095 2:120542492-120542514 CCCAGTATACTGCAGGAGGAAGG - Intergenic
938136811 2:128765827-128765849 CCCCACCCACTGAGGAAGGATGG + Intergenic
941540110 2:166771727-166771749 CCCCAACTACTCCAGGTGAATGG - Intergenic
942197397 2:173535078-173535100 CCCCACCTGTTGAAGGAGGGAGG + Intergenic
946114215 2:217447371-217447393 CCCCACCCACCGCAGGAGAAAGG - Intronic
947922946 2:233894080-233894102 CTTCATCTTCTGCAGGAGGAAGG + Intergenic
948379389 2:237542138-237542160 CCCCAGCTGCTGTGGGAGGAGGG + Intronic
948586542 2:239023564-239023586 CCTCCCCCACTGCACGAGGATGG + Intergenic
948943850 2:241209668-241209690 CCCCACATGGTGCAGGAGGATGG - Intronic
1168997154 20:2142060-2142082 CCCCGCACACTGCTGGAGGAGGG - Intronic
1169205935 20:3740401-3740423 CTCCACCTTTTGAAGGAGGAGGG + Intronic
1169269877 20:4191006-4191028 CCCCATCCACTGCAGTGGGATGG + Intergenic
1170539843 20:17376428-17376450 CCTCAAGTACTGTAGGAGGATGG - Intronic
1170759243 20:19235283-19235305 CCCTACCTAGTGCAGAAGTAAGG + Intronic
1170957252 20:20992319-20992341 CCCCACCCACTTCATGAAGAAGG - Intergenic
1171194773 20:23188102-23188124 CCCTGCCTCCTGGAGGAGGAGGG - Intergenic
1172318023 20:33971516-33971538 CCTCACCTAGGGCAGCAGGAAGG + Intergenic
1173234042 20:41227470-41227492 ACTCACATATTGCAGGAGGAAGG - Intronic
1174592642 20:51658437-51658459 CACCACCAACTGCAGCAGGATGG + Intronic
1175349823 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG + Exonic
1175584338 20:60126091-60126113 CCCCTGCTGCTGCAGGAGAAAGG + Intergenic
1175613449 20:60371792-60371814 GCCCACCTCCTGCAGAAGGCAGG + Intergenic
1176060328 20:63169674-63169696 CCCCACCTAATGCTGAGGGAGGG - Intergenic
1176230635 20:64031003-64031025 CCCCACCCGCTGCTGGAGAAGGG - Intronic
1178318951 21:31590381-31590403 CTCCCCCCACAGCAGGAGGATGG + Intergenic
1178703348 21:34852697-34852719 TCCCACCTAAAGCAGGAGCAAGG - Intronic
1179579595 21:42332740-42332762 CCACCCCAGCTGCAGGAGGATGG + Intergenic
1179714028 21:43278654-43278676 CCCCACAGACCCCAGGAGGAAGG + Intergenic
1180631332 22:17232253-17232275 CCCTCCCTGCTGCTGGAGGAAGG - Intergenic
1181966356 22:26658762-26658784 CCCCACCTGCTGCGGCGGGAGGG + Intergenic
1182442406 22:30372083-30372105 GCCCAGCAGCTGCAGGAGGAAGG + Exonic
1182777333 22:32840519-32840541 CCCCTCCCACTGCAAGAGCATGG - Intronic
1183270242 22:36857578-36857600 CCCCAGCACCTGCATGAGGAAGG + Intergenic
1183344325 22:37298805-37298827 CCCCAGCTCCTGAAGCAGGAAGG - Intronic
1183662528 22:39230030-39230052 CCCCAGCTGCTGCAGGGGAAGGG + Intronic
1183719388 22:39553465-39553487 CTCCACCTACTAAAGGAGGAAGG - Intergenic
1184606843 22:45579269-45579291 CCCCTCCTACGGAAGAAGGAAGG - Intronic
1185094623 22:48799609-48799631 ACCCACCTCCTCCAGGAGCAGGG - Intronic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
949557888 3:5173611-5173633 TCCCAGCTACGGCAGGAGAATGG + Intronic
953359054 3:42278983-42279005 CCCCACCTGTTGAAGGAGGGAGG + Intergenic
953879754 3:46685519-46685541 CCCAACCTGCAGCAGGACGAGGG + Exonic
954529242 3:51304138-51304160 CCCCACCCACTGAAGAAGAATGG + Intronic
956953200 3:74306494-74306516 CCCCACCTCCTCAAGCAGGAAGG + Intronic
960665112 3:120101195-120101217 CCCCAGCTACTGCGGGGGAAGGG - Intergenic
960707391 3:120494092-120494114 CCCCACCAATTGCAAGAGGTGGG - Intergenic
960943136 3:122947476-122947498 CCCCACCCACTCCTGCAGGATGG + Intronic
961531780 3:127544481-127544503 CCCCAGCTAAGGCAGGAGGAGGG + Intergenic
961568911 3:127784536-127784558 CCCCACCGCCTGCAGTGGGACGG - Intronic
961926880 3:130490705-130490727 CCACACCTAAGGCAAGAGGAAGG + Intergenic
962070940 3:132033700-132033722 GCCCACCTACTCCAAGATGAAGG + Intronic
962269402 3:133967048-133967070 GCCCACCTGTAGCAGGAGGATGG - Intronic
964060016 3:152510126-152510148 CCCCACCACCTTCAGGATGAAGG + Intergenic
964118390 3:153159701-153159723 CCCCTCGTAATGCAGGAAGAGGG - Intergenic
966909253 3:184549557-184549579 GGCCACCTACTGTAGGAGGGTGG + Intronic
967299366 3:187997528-187997550 CCCCTGCAATTGCAGGAGGAAGG + Intergenic
968081758 3:195851153-195851175 CCCCACGCATTGCAGGAGGCCGG - Intergenic
968546434 4:1201186-1201208 GCCCACATACTGCGGGGGGAGGG - Intronic
969399101 4:6941890-6941912 CCTCACCTAGGGCAGAAGGAAGG - Intronic
969402034 4:6962112-6962134 TCCCACCTGCTGCAGAAGGAGGG + Intronic
969698107 4:8747431-8747453 CCCCAACTCATGCAGGTGGAGGG - Intergenic
969718561 4:8880434-8880456 CCTTACCTACTGGAGGAGGCAGG + Intergenic
972421519 4:38891753-38891775 CCCCTCCAAGTGGAGGAGGATGG + Exonic
977937879 4:102827256-102827278 CCTCTCCTGCTGGAGGAGGAGGG - Intronic
978497693 4:109377746-109377768 CCCCACCTCCTGCAGGCTGAGGG + Intergenic
980292972 4:130869526-130869548 CCCCACGTGCTGAGGGAGGAAGG + Intergenic
980956983 4:139439115-139439137 TCCCAGCTACTCCAGGAGAATGG - Intergenic
983265143 4:165500567-165500589 CCCCACTTACTGCAGAGGGAGGG + Intergenic
984342150 4:178470858-178470880 TCCCAGCTACTGAGGGAGGAGGG + Intergenic
984626098 4:182009451-182009473 CCCCACCCACTGAGGAAGGATGG + Intergenic
986590438 5:9363407-9363429 CCTTACCTACTGCAGGAGGTGGG - Intronic
987072975 5:14355132-14355154 CCCCACCACCTGCATGTGGAAGG + Intronic
987353372 5:17041222-17041244 CTGCACCTACTGCAGGAGGGAGG + Intergenic
987834687 5:23146163-23146185 CCCCACCCACTGAGGAAGGATGG + Intergenic
988059515 5:26148974-26148996 CCCCACCCACTGAGGAAGGATGG - Intergenic
991570704 5:68050481-68050503 CCCCACCCACTTCACCAGGATGG + Intergenic
995003020 5:107158158-107158180 TCCCACCCACTGAAGAAGGATGG - Intergenic
995110993 5:108428586-108428608 CCCCACCCACTGAGGAAGGATGG + Intergenic
995666198 5:114544931-114544953 CCCCACCCAGTGAAGAAGGATGG - Intergenic
996893846 5:128456215-128456237 CCCCACCCACTGAGGAAGGATGG - Intronic
999793835 5:154969160-154969182 CCCCACCTAGTGACGGAGGGAGG + Exonic
1001093902 5:168761541-168761563 CCCCAACCACTGTAGGAGGTAGG + Intronic
1001120480 5:168975885-168975907 ACCCATCTCCTGCAAGAGGAAGG + Intronic
1002050729 5:176569070-176569092 CCCCACCTCCGGCAAGCGGACGG + Intronic
1002495559 5:179609100-179609122 ACCCAGCTACTGCCGGAGAATGG + Intronic
1002562444 5:180091377-180091399 CGCCACCAACTGCTGGATGATGG + Intergenic
1003313262 6:4987448-4987470 CCCCAGCTAGAGCAGGGGGATGG + Intergenic
1004594748 6:17088538-17088560 TCCCAGCTACTACAGGAGGCTGG - Intergenic
1006305491 6:33215854-33215876 CCACACTTTCTGCAGGAGTAGGG - Intergenic
1007524438 6:42479664-42479686 CCCAACCCAATGCAGGAGTATGG + Intergenic
1008741579 6:54615188-54615210 CCCCACCCACTGAGGAAGGATGG - Intergenic
1008773642 6:55009116-55009138 CCCCACCCACTGAGGAAGGATGG + Intergenic
1011730884 6:90262074-90262096 CCCCACTGACTACAGGATGAAGG + Intronic
1013751421 6:113411188-113411210 CCCCACCCAAAGCAGGAGGCAGG - Intergenic
1014084781 6:117330241-117330263 CCCCACCCACTGAGGAAGGATGG - Intronic
1014369265 6:120584338-120584360 CCCCACCCACTGAAGAAGGATGG + Intergenic
1015259353 6:131217331-131217353 CGCCACCTGCTGCAGCTGGATGG + Intronic
1015499882 6:133920975-133920997 CCACACCTGCTGCAGGAGCATGG + Intergenic
1015525754 6:134174753-134174775 CCTCACTTACTCCAGGATGAGGG - Intronic
1016583218 6:145653198-145653220 CCCCACGTATTGATGGAGGAAGG + Intronic
1017182297 6:151564938-151564960 CCCCACCTTCTCCAGCAGCAGGG - Intronic
1019720816 7:2569489-2569511 CCTCACCCTCAGCAGGAGGAGGG + Intronic
1020721607 7:11751833-11751855 CCCGACCCATTTCAGGAGGATGG - Intronic
1023965883 7:44962890-44962912 CCCTCCCTGCGGCAGGAGGAGGG + Exonic
1024430802 7:49285864-49285886 CCCCAGCACCTGGAGGAGGAAGG + Intergenic
1025216603 7:57061215-57061237 CACCACGTACTGCAGGAAGAAGG + Intergenic
1025654776 7:63509515-63509537 CACCACGTACTGCAGGAAGAAGG - Intergenic
1026975556 7:74495625-74495647 CTCCACATCCTGGAGGAGGAGGG + Intronic
1027329797 7:77079800-77079822 CCCCACCTCCTGAAGCAGGAAGG - Intergenic
1029575768 7:101402329-101402351 CCCCGCTGATTGCAGGAGGATGG + Intronic
1029785965 7:102791539-102791561 CCCCACCTCCTGAACCAGGAAGG + Intronic
1030701553 7:112646821-112646843 CCCCACCCACTGAGGAAGGATGG + Intergenic
1032127673 7:129206449-129206471 CCCTTCCTGCTGCAGGTGGATGG + Exonic
1032447793 7:131999659-131999681 CCTCTCCTACTGGAGGAGAATGG - Intergenic
1034172230 7:149071480-149071502 CCACACTTCCTGCAGGAGAACGG + Exonic
1035698025 8:1614996-1615018 CGCTACCTGCTGCAGGAGGGCGG + Intronic
1037785626 8:21901411-21901433 CCCCAGCCACTGCAGGATGGGGG + Intergenic
1038335414 8:26641751-26641773 CCCCACCCCCAGCAGGAGGGAGG - Intronic
1038503356 8:28063526-28063548 ATCCACCTCCTGCAGGAGGAAGG - Intronic
1038517208 8:28197254-28197276 CCCCATTTCCTGGAGGAGGAAGG - Intergenic
1039039442 8:33393547-33393569 CCTCTCCTTCTGCAGGAGCATGG + Intronic
1040820662 8:51553127-51553149 CCCCACCTTGTCCAGGAGGCAGG - Intronic
1041427528 8:57739120-57739142 CCCCAACAACTTCAGGAGAAGGG - Intergenic
1041912391 8:63102793-63102815 CCCACCCAACTGCAAGAGGAGGG - Intergenic
1044741515 8:95332234-95332256 CCCACCCCACTGCAGGAGAATGG - Intergenic
1048513169 8:135080540-135080562 CCTCACTTAGTGCAGGAGGTAGG + Intergenic
1048865827 8:138760861-138760883 CCCCAGCTCCTGCAGGAGCAGGG + Intronic
1049204904 8:141359159-141359181 CCCCACCTGCTGGAGAAGGGAGG + Intronic
1049238262 8:141523610-141523632 CCTCACCCACTGCAGGAGCCAGG - Intergenic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1049548281 8:143244968-143244990 CCCCTCCTACAGCAGCTGGAGGG - Intergenic
1052182421 9:25545964-25545986 CCCCTCCTACCTCTGGAGGAAGG - Intergenic
1052546661 9:29889015-29889037 CCCCACCCAGTGAAGAAGGATGG - Intergenic
1053098856 9:35352392-35352414 TCCCACATTCTGCAAGAGGATGG - Intronic
1054745956 9:68853947-68853969 CCCCTCCCACTGCTGGAGGCCGG + Intronic
1055149773 9:72982528-72982550 CCCCACCTGCTTCATGATGATGG + Intronic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1056736523 9:89214725-89214747 CCCCAGCAACTGCTGGAGGCAGG + Intergenic
1057846501 9:98530310-98530332 CCCCACCTACCACAGAAGCAGGG - Intronic
1058756754 9:108089670-108089692 CCCCACAAACTCCAGGATGAAGG - Intergenic
1058918217 9:109587871-109587893 CCTCAGAGACTGCAGGAGGAAGG + Intergenic
1059746197 9:117204080-117204102 CCCCACCCACTGAGGAAGGATGG + Intronic
1060112270 9:120914702-120914724 CCCCATGAACTTCAGGAGGAGGG - Intronic
1060207652 9:121691740-121691762 TCCCACCTTCTTCCGGAGGAAGG + Intronic
1060980104 9:127786622-127786644 CCTCCCCCACTACAGGAGGAGGG - Intronic
1061084375 9:128390587-128390609 TCCCACCTCCTGCAGGAAGCAGG + Exonic
1061374363 9:130215333-130215355 CCCTTCCCACAGCAGGAGGAAGG - Intronic
1061822097 9:133234618-133234640 TCCCACCTCCTGAAGGATGAAGG + Intergenic
1061832554 9:133304826-133304848 TCCCACATCCTGGAGGAGGAAGG - Intergenic
1185761762 X:2693889-2693911 CCCCACCCATTGCAGGATGGTGG - Intronic
1188722790 X:33543821-33543843 CCCCACCAACTTCAGCAGCAGGG + Intergenic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1190049650 X:47140288-47140310 TCCCACTAACTGCAGGGGGAGGG + Intergenic
1190726550 X:53193938-53193960 CTCCGCCTTCTGGAGGAGGAGGG + Intronic
1197761685 X:130032530-130032552 CCCTACTCACTGTAGGAGGAAGG + Intronic
1198469047 X:136929186-136929208 ACACACCTACTATAGGAGGAAGG + Intergenic
1199865701 X:151848197-151848219 CCTCACCCACTGCAGGACGGAGG - Intergenic