ID: 1160033149

View in Genome Browser
Species Human (GRCh38)
Location 18:75279508-75279530
Sequence CCTCCCATGGGAAGGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160033139_1160033149 4 Left 1160033139 18:75279481-75279503 CCCTCCTGTTTGTCAGACACTGC 0: 1
1: 1
2: 2
3: 23
4: 252
Right 1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG 0: 1
1: 0
2: 1
3: 26
4: 296
1160033138_1160033149 8 Left 1160033138 18:75279477-75279499 CCGGCCCTCCTGTTTGTCAGACA 0: 1
1: 0
2: 1
3: 32
4: 255
Right 1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG 0: 1
1: 0
2: 1
3: 26
4: 296
1160033140_1160033149 3 Left 1160033140 18:75279482-75279504 CCTCCTGTTTGTCAGACACTGCA 0: 1
1: 0
2: 1
3: 34
4: 353
Right 1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG 0: 1
1: 0
2: 1
3: 26
4: 296
1160033137_1160033149 11 Left 1160033137 18:75279474-75279496 CCGCCGGCCCTCCTGTTTGTCAG 0: 1
1: 0
2: 0
3: 23
4: 214
Right 1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG 0: 1
1: 0
2: 1
3: 26
4: 296
1160033141_1160033149 0 Left 1160033141 18:75279485-75279507 CCTGTTTGTCAGACACTGCAGCC 0: 1
1: 0
2: 1
3: 7
4: 166
Right 1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG 0: 1
1: 0
2: 1
3: 26
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160033149 Original CRISPR CCTCCCATGGGAAGGCTGGA TGG Intronic
900421025 1:2556009-2556031 CGTCCCCTGGGAGGGGTGGAAGG - Intronic
901638496 1:10681367-10681389 CCTCACATGGGCTGGCTGGCAGG - Intronic
901858378 1:12058716-12058738 CTTCCCATGGGCAGGAGGGAAGG - Intergenic
902396688 1:16135746-16135768 CCCCCCAAGGTGAGGCTGGAGGG - Exonic
902584156 1:17427788-17427810 CCTCCCAAGGAAGGGCTGGAGGG + Intronic
902694211 1:18129372-18129394 ACACCCTTGGGAAGACTGGAAGG - Intronic
903546229 1:24124965-24124987 TCACCCATAGGGAGGCTGGATGG + Intronic
903766535 1:25738597-25738619 CCTCAGCTGGGAAGGCTTGAAGG + Intronic
903776774 1:25798924-25798946 CATCCCGTGGGAAGCCTGGGAGG + Intergenic
903885757 1:26540115-26540137 TCTCCCCTGGGCAGGCTGAAGGG - Intronic
904092335 1:27954227-27954249 CCACCCATGGGAAAGATGGGAGG + Intronic
905187657 1:36208158-36208180 GCTCACATGGGCAGCCTGGAGGG - Intergenic
905966731 1:42104657-42104679 CCTCCCCTGGGAAGGTTGGCTGG - Intergenic
906044884 1:42820960-42820982 CCTCCCATCCCAAGCCTGGAAGG + Intronic
906921049 1:50064712-50064734 CCTCCCATGTGAAGGCTTGCTGG + Intronic
910417523 1:87016327-87016349 CCTCCCATTAGAAACCTGGATGG + Intronic
915585261 1:156840827-156840849 CCTCCCATGGGGAGACAGGAAGG - Exonic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
917120946 1:171644095-171644117 CCTCCCATGGCAACTGTGGATGG - Intronic
918278045 1:182973561-182973583 CCATCCATGGGAACGCTGGCAGG + Intergenic
920195308 1:204222648-204222670 ACTCCCATGGGAATGCCGCAGGG - Exonic
1063073644 10:2692235-2692257 GCTCCCCTGGGAAAGCTGCAAGG - Intergenic
1063113393 10:3055549-3055571 CATCCCACGGGAAGGTGGGAGGG + Intergenic
1063181126 10:3601426-3601448 CCTCTCATGGAAAAGGTGGAAGG + Intergenic
1067236939 10:44458996-44459018 CCTCCCAGAGGACTGCTGGATGG + Intergenic
1067246733 10:44553775-44553797 TCTGCCATGGGAAGGCAGGCCGG + Intergenic
1067690889 10:48501414-48501436 CCTCCCATGGGGAGGCCTCAGGG - Intronic
1067703225 10:48588624-48588646 CCACCTTTGGGAAGGGTGGAGGG - Intronic
1068659961 10:59613525-59613547 CCTCACATGGGAAGGGGTGAGGG + Intergenic
1069710026 10:70482167-70482189 CCTCTCCTGTGAAAGCTGGAGGG + Intronic
1070453156 10:76582060-76582082 TCTCCCATTAGTAGGCTGGAAGG - Intergenic
1070591744 10:77806679-77806701 CCTCCCATGGGACAGCTCCATGG + Intronic
1072415336 10:95242255-95242277 CCTCCCAAAGGAAGGGAGGAAGG - Intronic
1072432785 10:95388306-95388328 CCTCCCAGGAGAAGGCAGCAAGG - Intronic
1073495891 10:103890631-103890653 CCTGGCATGGGAAGGCCGGGTGG - Intronic
1074523413 10:114244856-114244878 CCTCCTGTGGGAGGGCTAGAGGG - Intronic
1074744905 10:116522881-116522903 ACTCTCCTGGGGAGGCTGGAAGG + Intergenic
1074788166 10:116859956-116859978 CTTCCCATGGGAGGGTGGGATGG + Intronic
1076797916 10:132807766-132807788 CTCGCCATGGGAAGGCCGGAGGG - Intergenic
1076847302 10:133075605-133075627 CCTCCCAGGGCAATGCTGCAGGG - Intronic
1077088459 11:766427-766449 CCTCCTGTGGGAAGCCTTGAAGG - Intergenic
1077232535 11:1464479-1464501 CCACCCATGGGATGGCAGGTGGG + Intergenic
1083170677 11:60922417-60922439 CCTCACCAGGGAAGGTTGGAGGG + Exonic
1084936921 11:72591805-72591827 CCTGCCATGGTGAGGATGGACGG + Intronic
1085512315 11:77094598-77094620 CCTCCCAAGGGATGGCAGAAGGG - Intronic
1085636657 11:78164469-78164491 CCTCCCCTGGGAACTCTGGTGGG - Intergenic
1085645379 11:78219106-78219128 CCTCCCAGGGGAAGGGTTCAGGG + Exonic
1086051831 11:82601276-82601298 CCTCACATGGGAAGGGGCGAGGG + Intergenic
1086863386 11:91951262-91951284 CCTCCCATGGGTAAGCAGGGAGG + Intergenic
1087132911 11:94684343-94684365 CCTCCCATTGGATGACTGGATGG - Intergenic
1087182147 11:95151258-95151280 CCTCCCCGGGAAAGGCTGGGCGG + Intergenic
1087861505 11:103163461-103163483 GATCCCATGGGAGGGATGGACGG - Intronic
1090663914 11:128902299-128902321 CCTTCCAGAGGAGGGCTGGAGGG - Exonic
1092538170 12:9405251-9405273 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538181 12:9405277-9405299 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538192 12:9405303-9405325 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538203 12:9405329-9405351 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538214 12:9405355-9405377 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538225 12:9405381-9405403 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538236 12:9405407-9405429 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538247 12:9405433-9405455 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538258 12:9405459-9405481 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538269 12:9405485-9405507 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538280 12:9405511-9405533 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538291 12:9405537-9405559 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538302 12:9405563-9405585 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538313 12:9405589-9405611 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538324 12:9405615-9405637 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538335 12:9405641-9405663 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538346 12:9405667-9405689 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538357 12:9405693-9405715 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538368 12:9405719-9405741 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538379 12:9405745-9405767 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092538390 12:9405771-9405793 CCCCCCATGGCAAGGCGGGGAGG + Intergenic
1092915204 12:13183134-13183156 ACTCCCCAGGGAAGGATGGATGG - Intergenic
1094449035 12:30564559-30564581 CATGCCATGGGATGACTGGATGG + Intergenic
1096503029 12:52076881-52076903 CATCCCATGGGAAGTGTGGACGG + Exonic
1097284061 12:57864376-57864398 CCTCTCATGGAAAGGCAGGGTGG - Intergenic
1100478916 12:94959405-94959427 CCCCACCTGGGGAGGCTGGAGGG - Intronic
1101446087 12:104737858-104737880 TGTCCCCTGGGAAGGCTGGGTGG + Intronic
1102132499 12:110542971-110542993 CCTCCCCAGGGAGGCCTGGAAGG - Intronic
1102513757 12:113433326-113433348 TCTCCCAAGGGAGGGATGGAGGG - Intronic
1102885116 12:116516150-116516172 CCTCCCCTGGGAGAGCTGCATGG - Intergenic
1104201385 12:126593123-126593145 ACCCCCAGGGGAAGACTGGAGGG + Intergenic
1104402261 12:128485787-128485809 CATCCAGTGGGATGGCTGGAAGG - Intronic
1104675148 12:130707354-130707376 CCTCCCATGGGGAGGGAGGGAGG + Intronic
1104896563 12:132167746-132167768 CCTCTCAAGGGCAAGCTGGAAGG + Intergenic
1105890908 13:24681422-24681444 CCTCCTCTGGGGAGGCCGGAGGG - Intronic
1106769543 13:32948555-32948577 CCTCCCATGGGGAAGCAAGAAGG - Intergenic
1107153428 13:37139183-37139205 CCTCCCCTGGGAAGCCAGTATGG - Intergenic
1107975633 13:45686058-45686080 ACTCACAGGGGAAGGCTGGGAGG + Intergenic
1108266181 13:48711359-48711381 CCTCCCATGGCAGGACTAGATGG - Intergenic
1108482711 13:50890976-50890998 CCAGGCAAGGGAAGGCTGGAAGG - Intergenic
1108487358 13:50940539-50940561 CCTCCCATGGGATGGAGAGATGG + Intronic
1108490184 13:50974243-50974265 GCTCAGATGGGAAGTCTGGATGG - Intergenic
1108684191 13:52804663-52804685 TCTGCCCTGGGAAGGCTGGGAGG - Intergenic
1108825432 13:54407655-54407677 TCTCCAATGGGGAGGGTGGAGGG - Intergenic
1111115258 13:83768156-83768178 TCTCCATTGGGAAGGCTGGCTGG - Intergenic
1112622312 13:101065184-101065206 CCTCGCAGGGGAGGGCTGGGCGG - Intronic
1113731133 13:112642288-112642310 CCTGCAATGGGAAGGCGGGGTGG + Intergenic
1114410362 14:22494972-22494994 CCTCCCACTGGAAGGAAGGAAGG - Intergenic
1115741916 14:36397850-36397872 CCATCCATGGGATGGCTGGGTGG - Intergenic
1116589651 14:46755336-46755358 CCTCCAAGGGGCAGGCTGGAGGG + Intergenic
1117439275 14:55744986-55745008 CCACACATGGGCAGCCTGGAGGG - Intergenic
1118596919 14:67442848-67442870 CTTCCCTTTGGGAGGCTGGAAGG - Intergenic
1118861991 14:69671562-69671584 AATTCCATGGGGAGGCTGGAGGG + Intronic
1118989037 14:70781405-70781427 CCTCACCTGGGAAGACTTGAAGG - Intronic
1119783113 14:77291653-77291675 CCTCCCTCTAGAAGGCTGGATGG - Intronic
1122410157 14:101521658-101521680 CCTGCCGTGGGAGGGCTGGCGGG - Intergenic
1125903606 15:43370873-43370895 GCTCCCAGGGGTGGGCTGGAGGG - Intronic
1128745501 15:70111478-70111500 CCTGCCCAGGGAAGGCTGGCTGG - Intergenic
1129604820 15:77019730-77019752 CCTCCCAAGGGAAGGGCTGAGGG + Intronic
1129607029 15:77030022-77030044 CTTCCCAGGGGAAGGGAGGAGGG - Intronic
1130168164 15:81484339-81484361 CTTCTGATGGGAAGGCTTGAAGG - Intergenic
1132023233 15:98382775-98382797 CTGGCCATGGGAAGGATGGAGGG - Intergenic
1132252178 15:100342048-100342070 CTTCCCCTCGGAAGGCGGGAGGG + Intergenic
1132485544 16:188733-188755 TCTCCCATGGGGAGGAGGGAGGG - Intergenic
1133406347 16:5527621-5527643 CCTCCAATGGGAAGACAGGGAGG - Intergenic
1133441025 16:5820969-5820991 CCTCCTCTGGGAGGGCAGGAAGG + Intergenic
1133725543 16:8534074-8534096 GCTCTCATGGCAAGGCTGCAGGG - Intergenic
1135460140 16:22635085-22635107 CATCCCCTGGGAAGGCAGGATGG - Intergenic
1135648269 16:24182705-24182727 CCTCCCATCTGTGGGCTGGAGGG + Intronic
1135665455 16:24331841-24331863 CCACCCATGGGAAGATTTGAGGG - Intronic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1137489860 16:48923356-48923378 GCTCTCATGGGAACTCTGGAGGG + Intergenic
1140922071 16:79548686-79548708 CCTCCCTGGGGAAGTCTGCAGGG - Intergenic
1141132937 16:81447320-81447342 CCTGCCATGGGAAGGCCAGGAGG + Intronic
1142308256 16:89297874-89297896 GCTCCCATCGGCAGGCGGGAGGG - Intronic
1143027225 17:3948019-3948041 ACTCTCATGGGAAGGCAGCAGGG - Intronic
1143031199 17:3968193-3968215 CCTCCCCTGGGGAGGCCTGAAGG - Intergenic
1143308982 17:5972572-5972594 CGTCTCAAGGGAAGGCTGGAGGG + Intronic
1143756478 17:9071639-9071661 CCGCCCATGGGCAGGCAGGTGGG - Intronic
1143918724 17:10313995-10314017 CCTCCCATTGGAGGGATGTAAGG + Intronic
1144574496 17:16420360-16420382 CCTCCCACTGGAAGGATGGCTGG + Intronic
1144854393 17:18260081-18260103 CCTCCCCTGCGAAGGATGGTTGG - Intergenic
1145252202 17:21302805-21302827 TTTCCCTTGGGAAGGCTGGGTGG - Intronic
1145777884 17:27541996-27542018 CATCCCATCAGAAGTCTGGAAGG + Intronic
1146273920 17:31502688-31502710 CCTCCCCTAGGAAGGCTTCATGG - Intronic
1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG + Intergenic
1147760636 17:42795484-42795506 CCTCCCAGGGGAAGCCAGGCTGG + Exonic
1148123046 17:45223442-45223464 TCTCCCAAGAGAAGGCTGGGGGG + Intronic
1148123391 17:45224943-45224965 CCTCCCAGGGGAAGGCATGAAGG - Intronic
1149612164 17:57965716-57965738 CCTCCAACGGTAGGGCTGGAGGG - Intergenic
1150009409 17:61490433-61490455 CCTCCCATGGAAGGGTTTGAAGG - Intergenic
1150281855 17:63933533-63933555 CCTCCCATGCCATGGTTGGAAGG + Intergenic
1151170169 17:72239119-72239141 CATCCCATTAGAATGCTGGATGG + Intergenic
1151309700 17:73285701-73285723 CCTCCCCTGGCAAGGCAGGAAGG - Exonic
1151412092 17:73937722-73937744 CCTCCCGTGGCAAGGAGGGAGGG - Intergenic
1151930304 17:77227958-77227980 CCTCCTGTGGCATGGCTGGAAGG + Intergenic
1151951245 17:77355419-77355441 CCTCCCATGGGCTGGCAGCAGGG - Intronic
1152367626 17:79865794-79865816 CCTCCACGGAGAAGGCTGGAAGG + Intergenic
1152493574 17:80654324-80654346 CCTCCCAGGTGAGGGCTGCACGG + Intronic
1152565449 17:81098217-81098239 GCACCCATGGGCAGGCTGGGAGG + Intronic
1152580142 17:81162199-81162221 GGTCCCATGGGAAGGCTGTGTGG - Intronic
1152603015 17:81274584-81274606 GCTCCCAAGGGGAGGCAGGAGGG + Intronic
1154154930 18:11936612-11936634 CTTCCCAGGGGAGGGGTGGAGGG + Intergenic
1157276208 18:46312751-46312773 CCTCCCCTGGGCAGGTGGGAAGG - Intergenic
1157299534 18:46469524-46469546 TCTGCCATGGGCAGGCTGCAAGG + Intergenic
1158638249 18:59180031-59180053 CCTCCAGAGGAAAGGCTGGAAGG - Intergenic
1158671560 18:59478943-59478965 GCTGCCATAGGAAGGCTGGCTGG - Intronic
1159558583 18:69970514-69970536 CCTCCCATGGGTGGGCTGTGAGG - Intergenic
1160018466 18:75162356-75162378 CCTCTCATGGGAAGCCTGCCTGG - Intergenic
1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG + Intronic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161567927 19:5013675-5013697 CCTCCCATGAGGAGGCTGTGAGG + Intronic
1162781545 19:13009542-13009564 ATTCCCATGGGAAGGCCAGAAGG - Intronic
1162799102 19:13101268-13101290 CCTCAAATGGGAAGGAGGGAGGG + Intronic
1162803163 19:13122167-13122189 CAGCACATGAGAAGGCTGGAGGG - Intronic
1163846397 19:19640566-19640588 CCTCCCCTGGGGAAGATGGATGG + Exonic
1163847658 19:19646559-19646581 GCTGCCATGGGGAGCCTGGATGG - Intronic
1164798542 19:31056507-31056529 GGTACCATAGGAAGGCTGGAGGG + Intergenic
1165006920 19:32814872-32814894 CCTCCCATGGTGAGGGTGGGGGG - Intronic
1165111391 19:33504443-33504465 CATCGCATGGGAAGTCTGGATGG + Intronic
1165318078 19:35068771-35068793 CCTGCCCTGGGAAGTCTGGGGGG + Intergenic
1165462427 19:35952010-35952032 GCTACCATGGGGAGGGTGGATGG + Intergenic
1165718626 19:38063289-38063311 CCTGCCGTGGGAAGGCTGGCAGG - Intronic
1166695769 19:44850889-44850911 CCTCCCATGGCAAGGCACGTCGG - Intronic
925255703 2:2485251-2485273 CCTCTCCTGGAGAGGCTGGAGGG + Intergenic
926196836 2:10769108-10769130 CCTCCCCTGTGGAGGCTGCACGG + Intronic
927101489 2:19790712-19790734 CCTCTCAGGGAAAGGCTGAATGG + Intergenic
927637155 2:24824926-24824948 CTCCCCTTGGAAAGGCTGGAAGG + Intronic
927747810 2:25638202-25638224 CCTGTCATGGGATGGCAGGAGGG + Intronic
927854242 2:26517942-26517964 ACACCCATGGGAAGGCGGGCTGG - Intronic
928211713 2:29328552-29328574 GGTCCCATGGGCAGGCTGCAGGG + Intronic
929044702 2:37778192-37778214 CCTCCCCTGGGAAGCATGGCTGG + Intergenic
929914897 2:46126751-46126773 CCTCCCATGGGACTGCTCAAGGG - Intronic
931293807 2:60902337-60902359 TCTCCCCTGGTAAGACTGGAAGG - Intronic
934160969 2:89249239-89249261 CCTCCACTGGGAAAGCTGAATGG + Intergenic
934206308 2:89933194-89933216 CCTCCACTGGGAAAGCTGAATGG - Intergenic
937956856 2:127426569-127426591 GTTCCCATGTGGAGGCTGGAGGG - Intronic
940321586 2:152383184-152383206 CCTCCCTTGGAAACACTGGAAGG + Intronic
940888437 2:159011853-159011875 CCCCACATGGGAAGCCTTGATGG - Intronic
942825468 2:180169856-180169878 CCTCCCATCACAAGTCTGGAGGG - Intergenic
946308249 2:218868337-218868359 CCTCCCTTAAGAAGGCAGGAGGG - Intronic
946412337 2:219521613-219521635 GGTCCCATGGGCAGGCAGGAGGG + Intronic
946788160 2:223270089-223270111 CCTCCAGTGGGATGGCTCGAGGG - Intergenic
946996268 2:225395520-225395542 CCTCACATGGGAGGGAGGGAGGG - Intergenic
948084263 2:235233192-235233214 CCTCCCTGGGGAAGGCCAGATGG - Intergenic
948273117 2:236688864-236688886 CCTCCCATGGGAGGGAGGGCAGG - Intergenic
948589518 2:239040163-239040185 CCTCCCATGCGAAGGAAGGGAGG + Intergenic
948689230 2:239691513-239691535 CCTCCCAGGGAAAGACGGGATGG + Intergenic
948854890 2:240725460-240725482 GCCCCCAGGAGAAGGCTGGAAGG - Intronic
1171284818 20:23928471-23928493 ACTGCCATGGGGCGGCTGGAGGG - Intergenic
1171489828 20:25508956-25508978 CCTCACATGGGCAGGCTGAAAGG - Intronic
1172098736 20:32473376-32473398 ACCCCCGTGGGAACGCTGGAAGG + Intronic
1173092164 20:39983391-39983413 CCTCTCATGTAAAGGGTGGAGGG + Intergenic
1173932402 20:46831780-46831802 CCTCACATGAGAAGACTTGAAGG + Intergenic
1175283345 20:57820141-57820163 CATCCCATGGGAGGCCTGGGAGG + Intergenic
1175536737 20:59720034-59720056 CCTCCTATGAGAGAGCTGGAAGG - Intronic
1175930450 20:62491455-62491477 CACCCCAGAGGAAGGCTGGAAGG + Intergenic
1176371110 21:6061804-6061826 ACTCCCCTGGGAATGCTAGAAGG - Intergenic
1179752409 21:43476737-43476759 ACTCCCCTGGGAATGCTAGAAGG + Intergenic
1179997975 21:44982602-44982624 CCTCCCACGGCAATGCTGCACGG - Intergenic
1180027800 21:45178272-45178294 CCTGGCTTGGGAAGGCTGGAGGG + Intronic
1180606639 22:17063983-17064005 CCTGCCAAGGGAAGGATGGGGGG + Intergenic
1180741581 22:18056913-18056935 CCTGTGATGGGAGGGCTGGAGGG - Intergenic
1180882506 22:19215997-19216019 CAGCCAATGGGCAGGCTGGATGG + Intronic
1182318487 22:29463498-29463520 CCTGCCATGGGTGGGCTGGATGG - Intergenic
1182980439 22:34665697-34665719 CCCCGCATGGCAAAGCTGGAGGG + Intergenic
1183254904 22:36756122-36756144 CTTCCCCTGGCAGGGCTGGAGGG - Intergenic
1183255763 22:36760894-36760916 CCTCCTTTGGGTAGGCAGGATGG + Intronic
1183663293 22:39233887-39233909 CTTCCTATGGGAACGCTGGGTGG - Intronic
1184210100 22:43030388-43030410 ACCCTCAGGGGAAGGCTGGAAGG - Intergenic
1184738220 22:46411526-46411548 CCTGCCCTGGGAAGGCCGCAGGG + Intronic
1185106386 22:48872177-48872199 CCTGTCATGGGGAGGCAGGAGGG - Intergenic
1185176050 22:49327603-49327625 ACTCCCCAGGGGAGGCTGGAGGG + Intergenic
1185235392 22:49709464-49709486 CCTTCCAAGGGAAGCCAGGAAGG + Intergenic
952311896 3:32198233-32198255 CCTCCCTTGGGATGGCAGGCTGG + Intergenic
953011624 3:39030999-39031021 CCTCCAGTGGGAAAGCTAGATGG + Intergenic
953666375 3:44929023-44929045 CCTGCCATGGGGGGGATGGAAGG + Intronic
953680213 3:45033486-45033508 CCTCCCATGTGTATGCTGGTTGG - Intronic
953976653 3:47386558-47386580 CATCCCATGGAAAATCTGGAAGG - Intronic
955241766 3:57184729-57184751 CTTCCCATGTCAAGGCGGGATGG - Intergenic
955245696 3:57222593-57222615 CCCCACATGGGAATTCTGGAAGG - Intronic
960801510 3:121545331-121545353 GCGTCCAGGGGAAGGCTGGAAGG - Intronic
960946108 3:122967816-122967838 CCTCCTCTGGGAAGGCAGAAAGG - Intronic
961195340 3:124996702-124996724 CCTCTCATGGGAAGTCCTGATGG + Intronic
961447466 3:126987638-126987660 CCTCCACAGGGAAGGCTGGCAGG - Intergenic
962343439 3:134603513-134603535 CCTCCCCAGGGAGGGCTCGAAGG - Exonic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962926685 3:140000034-140000056 CCTCACATGAGAAGGAAGGAAGG - Intronic
963626739 3:147682843-147682865 CCTCTCGTGGGATGGCGGGAGGG - Intergenic
963843397 3:150130781-150130803 CTTCCCAGGAGAAGCCTGGAGGG + Intergenic
963947661 3:151163995-151164017 CCCGGCATGGGGAGGCTGGACGG - Exonic
967618938 3:191608188-191608210 GCTCCCATGGAAAGGATGGGAGG + Intergenic
969097378 4:4743850-4743872 TGTCCCAGGGGAAGGCTGGCAGG - Intergenic
971258088 4:25031463-25031485 CCTCCCATGGGAGGACTGGCTGG - Intergenic
972243563 4:37220646-37220668 CCTCCCATGAGATAGCTGGCAGG - Intergenic
985126856 4:186703058-186703080 CCTTCCATGTGAGGTCTGGAAGG - Intronic
985794190 5:1949858-1949880 CCTCCCACAGGAAGTCTGCAAGG - Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
987059017 5:14224543-14224565 ACTAGCTTGGGAAGGCTGGATGG + Intronic
988275937 5:29080995-29081017 CTTCCCCTGGCAAGGGTGGAGGG + Intergenic
988659231 5:33246571-33246593 CCTCCCAGTGGCAGGCTGGTTGG - Intergenic
989646547 5:43639611-43639633 CCTCCCATATGCAGGGTGGATGG - Intronic
990098794 5:52156556-52156578 CTTCCCAAGGGAAGCCTTGAAGG + Intergenic
990620620 5:57555086-57555108 CTTCCCTTAGGATGGCTGGAGGG + Intergenic
990620823 5:57556734-57556756 CTTCCCTTGGGATGGCTGGAGGG + Intergenic
991295747 5:65078468-65078490 ACTCCCATGGAGAGCCTGGAAGG + Intergenic
991424456 5:66476334-66476356 TCTCCCATGAGAAGACAGGATGG - Intergenic
992769399 5:80033444-80033466 CCTCCAATGTCATGGCTGGAGGG + Intronic
993091430 5:83431413-83431435 GCTGCCATGGGACTGCTGGAAGG - Intergenic
995344137 5:111092258-111092280 CCTCCCATGTGAGCTCTGGAGGG + Exonic
997211381 5:132078957-132078979 CCTCCTAGAGGATGGCTGGAAGG + Intergenic
999718537 5:154381243-154381265 CCTAGAATGTGAAGGCTGGAAGG + Intronic
1000673426 5:164090644-164090666 CATCCCTTGGGGTGGCTGGAAGG - Intergenic
1000908214 5:166989189-166989211 CCTCCCAGTGGATGGGTGGATGG + Intergenic
1001365304 5:171132243-171132265 CCACCCAAGGGAAGGAAGGAGGG + Intronic
1001963686 5:175895484-175895506 CCTCACACGGACAGGCTGGAAGG + Intergenic
1002333372 5:178460985-178461007 ACTCCCATGGGAAAGTCGGATGG + Intronic
1002821030 6:724705-724727 CATCCCTTGGAAGGGCTGGAAGG - Intergenic
1003458895 6:6310913-6310935 GCTTCCCTGGGAAGGCTGGAAGG - Intronic
1004017192 6:11743075-11743097 CATCCCATGAGAAGGCAGGACGG - Intronic
1004051891 6:12090533-12090555 CCTTCCATGGGAGCTCTGGAAGG + Intronic
1007702835 6:43774428-43774450 CCTCTCAGGGGATGGGTGGATGG + Intronic
1007962173 6:45969880-45969902 GCTCCCAGGGGAAGGATAGAAGG + Intronic
1011780472 6:90783952-90783974 CACCCTATGAGAAGGCTGGAGGG - Intergenic
1013895098 6:115078642-115078664 CCTCTTAAGGGAAGGCTAGAGGG - Intergenic
1014257085 6:119171791-119171813 CCTCCTATGTGAAGAATGGAAGG + Intergenic
1017673266 6:156788013-156788035 CCCCACATGGGAAGGCAGGTAGG - Intronic
1017906607 6:158761010-158761032 CCTCCCAGGGGCAGATTGGATGG + Intronic
1018874745 6:167811913-167811935 CCTCCCATGAGGGGGCTGAAGGG + Intergenic
1019260877 7:81371-81393 CCTCCCATGTGAGGGCTGTAAGG - Intergenic
1019571379 7:1714058-1714080 CCTCACACGGGCGGGCTGGAAGG + Intronic
1019934266 7:4244140-4244162 ACTCTGCTGGGAAGGCTGGAGGG - Intronic
1020400693 7:7773862-7773884 CCTCCCAGGGCAGGGCTGCAAGG - Intronic
1021328436 7:19303684-19303706 TCTCCCATGGCATGGCTGTAGGG - Intergenic
1021480234 7:21107324-21107346 ACTCCCATGGGCAGGCAGTATGG + Intergenic
1024510769 7:50203080-50203102 CTTCCCATGGGAAGCTTGCAGGG - Intergenic
1028334660 7:89636807-89636829 CCTCCCATGGCTAGGATTGAAGG + Intergenic
1029404467 7:100366435-100366457 CCTCCCAGGAGGGGGCTGGATGG + Intronic
1030083391 7:105797197-105797219 CCTGCCACGGCTAGGCTGGAAGG + Intronic
1030871450 7:114760838-114760860 CATCCCATGGGGAGGCAGAAAGG - Intergenic
1033757040 7:144403979-144404001 CCTCCCGTGGCGGGGCTGGAGGG + Intronic
1034509363 7:151521003-151521025 GCTTCCGTGGGAAAGCTGGAGGG - Intergenic
1035049307 7:155989517-155989539 CCTTCCCTGGGAAGGCTGCAGGG + Intergenic
1036699825 8:11005387-11005409 TCTCCAATGGAAGGGCTGGAGGG + Intronic
1037722462 8:21456271-21456293 GCTTCCAGGGGATGGCTGGAGGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037920284 8:22801012-22801034 CTGCCCTTGGGGAGGCTGGATGG - Intronic
1039854947 8:41403952-41403974 CTTCCTAAGGGAAGGCAGGAAGG + Intergenic
1046103276 8:109639020-109639042 GCTCCCATGGGAAAGCAAGAGGG + Intronic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1051507016 9:17838565-17838587 CCTTTCACGGGAAGGGTGGATGG - Intergenic
1052840814 9:33289691-33289713 CCTACCCTGGGAAGCCAGGAAGG + Intergenic
1054938249 9:70712312-70712334 CCAGACATGTGAAGGCTGGAGGG + Intronic
1054939940 9:70730305-70730327 CCAGACATGTGAAGGCTGGAGGG + Intronic
1055277095 9:74630346-74630368 CATCACATGTGAAGGCTGCAAGG + Exonic
1056766778 9:89448927-89448949 CCTCCCACGGGAAGGCAGGATGG + Intronic
1057236538 9:93366076-93366098 GCAGCCATGGGGAGGCTGGAGGG + Intergenic
1057551831 9:96056844-96056866 CCTCCCTTTGAAAGGATGGAAGG + Intergenic
1058002649 9:99881871-99881893 CCTCAGCTGGGAAGGCTTGAAGG + Intergenic
1059540425 9:115124913-115124935 CCTACCATTGGAAGGCTGTGGGG - Intergenic
1059987358 9:119833657-119833679 TCACGCATGGGAAGGGTGGATGG - Intergenic
1060878885 9:127103871-127103893 ACTTCCACGGGAAGGCTGGAGGG - Intronic
1061796469 9:133088380-133088402 CCTCCCACCTGTAGGCTGGAGGG - Intergenic
1189830852 X:44971818-44971840 CCTCCCCTGTGCAGTCTGGATGG + Intronic
1190474694 X:50814448-50814470 CCTCGCCTGGGCTGGCTGGAGGG - Intergenic
1191167742 X:57407689-57407711 CATCTAATGGGAAGCCTGGAAGG + Intronic
1194286738 X:92020167-92020189 GCTCCCACGGGAAGACTGGCAGG - Intronic
1195928902 X:110053667-110053689 CAACCCATGGGAGGGATGGATGG - Intronic
1196739720 X:119014097-119014119 CTTCCCATAGGAAGGCAGGATGG + Intronic
1198039571 X:132836439-132836461 CCACAAATGGGAAGGCTGGAAGG + Intronic
1200604283 Y:5244727-5244749 GCTCCCACGGGAAGACTGGCAGG - Intronic