ID: 1160033350

View in Genome Browser
Species Human (GRCh38)
Location 18:75281057-75281079
Sequence GAGGGTCCAGACGCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160033350 Original CRISPR GAGGGTCCAGACGCCCTGCC TGG Intronic
900156577 1:1205624-1205646 CAGGGTCCAGACTCCCAGCCAGG - Intronic
900312912 1:2043080-2043102 GAGGGTTCAGAGGCCTTTCCTGG + Intergenic
900396318 1:2454603-2454625 GGGGCTCCAGAGGCCCTGCAGGG - Intronic
900590131 1:3455707-3455729 GAGGGTCCAGGTGCTGTGCCTGG + Intronic
902642055 1:17773266-17773288 CAGGGTCCAGACTCTCAGCCTGG - Intronic
902983639 1:20142448-20142470 CTGGGTCCACACGCCCAGCCTGG - Intronic
903886934 1:26546145-26546167 CAGGGTCCAGTCACCCTGCAGGG - Intronic
906542647 1:46599648-46599670 GAGGCTCCAAATGCCCTGACTGG - Intronic
908501307 1:64745580-64745602 TAGCCTGCAGACGCCCTGCCAGG + Intronic
916836910 1:168555132-168555154 GTGAGTCCAGTTGCCCTGCCCGG - Intergenic
920460873 1:206139209-206139231 GAGGGTCCCCAAGCCCTCCCAGG + Intergenic
922591057 1:226777359-226777381 GTGGCTCCAGAGGCCCTCCCTGG - Intergenic
923048528 1:230373384-230373406 GAGGGTTCTGAATCCCTGCCTGG + Intronic
1063018893 10:2105932-2105954 GAGGGTCCAGACAGCCCACCAGG - Intergenic
1067774172 10:49150095-49150117 CAGGTGCCAGACACCCTGCCAGG + Intergenic
1071523673 10:86346148-86346170 GAGTGTCCAGACACGCTGCTGGG + Intronic
1071570700 10:86695213-86695235 GAGGTCCCAGAGCCCCTGCCTGG - Intronic
1071794545 10:88990875-88990897 GAGGGTCCAGATGCCCAGCATGG - Exonic
1073247836 10:102104259-102104281 GTGGATCCAGAAGCCCTGGCTGG + Intergenic
1074859638 10:117500588-117500610 GAGGATCCAGGGTCCCTGCCTGG + Intergenic
1074895145 10:117770884-117770906 GAGGGGACAGACGCCTTCCCTGG + Intergenic
1075015072 10:118904431-118904453 GAGGGTCCGGAAGCCCAGCGGGG + Intergenic
1076461452 10:130650082-130650104 GAGGGCCCAGGTGTCCTGCCTGG + Intergenic
1076707204 10:132308329-132308351 GAAGGTCCCGCCGCCGTGCCGGG - Intronic
1076910861 10:133388663-133388685 GGGGGTCCGAAGGCCCTGCCAGG - Intronic
1077040764 11:521079-521101 CACGGGGCAGACGCCCTGCCAGG + Intergenic
1077077123 11:706861-706883 GGGGCTGCAGAGGCCCTGCCAGG + Intronic
1077332551 11:1989842-1989864 GAGGGGGCAGCCGCCATGCCGGG + Intergenic
1077724519 11:4661057-4661079 GAGGGCCCAGATGCGCTCCCTGG + Intergenic
1082783233 11:57302625-57302647 GAGGGTGGAGAGTCCCTGCCAGG + Exonic
1082991504 11:59211090-59211112 GAGGGTCCCTGCCCCCTGCCAGG - Exonic
1084767632 11:71323046-71323068 GAAGATCCACAGGCCCTGCCAGG - Intergenic
1085208058 11:74748995-74749017 GAAGGTCCAGAAGCCGGGCCTGG - Exonic
1086850012 11:91798423-91798445 TAGGGTGCAGGCCCCCTGCCGGG - Intergenic
1089196039 11:116694572-116694594 GAGGGCCCATTCGCCTTGCCCGG + Intergenic
1089643154 11:119860820-119860842 CAGGGTCTAGAAGCTCTGCCAGG - Intergenic
1089695982 11:120216610-120216632 GAGGGTTCAGACCCCCTCCCGGG + Intronic
1091174829 11:133548579-133548601 CAGGGTCCAGAGGCCTTGTCTGG - Intergenic
1202815532 11_KI270721v1_random:45018-45040 GAGGGGGCAGCCGCCATGCCGGG + Intergenic
1092289913 12:7153858-7153880 GAGTGTCCAGCTGCCCTGCATGG + Intronic
1097563568 12:61239367-61239389 GGGGGTCCAGAAGTGCTGCCTGG + Intergenic
1097710892 12:62915701-62915723 GAGGTTCCAGAGGACATGCCTGG + Intronic
1098347769 12:69524272-69524294 CAGGGTGCAGACACCCTGGCTGG + Intronic
1105708280 13:22982143-22982165 GAGGGTCCAGAGAACCTGGCTGG + Intergenic
1111955860 13:94757860-94757882 TGGGGTCCAGATGCCCTGCTGGG + Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1112601048 13:100856428-100856450 GAAGGTGCAGAGGCCTTGCCAGG + Intergenic
1113790038 13:113023402-113023424 GATGGTAAAGCCGCCCTGCCTGG + Intronic
1114255617 14:20999172-20999194 GAAACTCCAGACTCCCTGCCAGG - Intergenic
1117131865 14:52695321-52695343 GAGGGTCCCGGCGCCCTCCGCGG - Intronic
1122023165 14:98856119-98856141 GAGGGTCCAGACGCCTAGATGGG - Intergenic
1122405228 14:101496755-101496777 CAGGGTCCAGCCGCCTTCCCAGG + Intergenic
1125098125 15:35878216-35878238 CAGGGTCCACAAGCCCTGCCTGG + Intergenic
1125921778 15:43529324-43529346 GAAGATCCAGACGCCGTGCAGGG - Exonic
1128533477 15:68471234-68471256 GAGGCTACAGACGCACTGCATGG - Intergenic
1131133047 15:89912483-89912505 GAGGGTCCCGACCCCCAGACAGG - Intronic
1131371266 15:91883823-91883845 GTGGGTCCACACCCCGTGCCAGG + Intronic
1132153050 15:99475850-99475872 GAGGGTTCAGACCCCCTGTCCGG + Intergenic
1132347628 15:101118068-101118090 GTGGGTCCAGACACCCTCTCCGG - Intergenic
1132361379 15:101219001-101219023 CAGGCTCCAGTCGGCCTGCCTGG + Intronic
1132576757 16:667953-667975 CAGGGTCCTGGCGCCCTGGCAGG - Intronic
1136568694 16:31084460-31084482 GTGGGTCCAGAGGCCAAGCCTGG + Intronic
1138648624 16:58443940-58443962 GTGGGTTCAGACATCCTGCCTGG - Intergenic
1142280392 16:89144916-89144938 GAGGTGCCAGAAGCCCTGCTGGG - Intronic
1142302481 16:89266654-89266676 GAGGGTCCCTGAGCCCTGCCAGG - Intergenic
1143728389 17:8865767-8865789 GAGGGTCCTGCTGCCCTGGCTGG + Intronic
1144527090 17:15999665-15999687 GAGGATCCTGACCCCCCGCCGGG + Exonic
1147599755 17:41738541-41738563 GAGGGTGCAGAAGACTTGCCAGG + Intergenic
1148026568 17:44593115-44593137 GATGGTCCAGTCCCCCTGGCAGG + Intergenic
1148846793 17:50534302-50534324 GTGGGCCCAGCGGCCCTGCCTGG - Intronic
1149196944 17:54132663-54132685 GAGAGTTCAGACGCCATGCTGGG + Intergenic
1150307323 17:64096871-64096893 CAGGGTGAAGATGCCCTGCCTGG + Intronic
1151758910 17:76089783-76089805 GATGTTCCAGAAGCCCTGACTGG - Intronic
1152407926 17:80108068-80108090 GAGGGTTCTGGGGCCCTGCCTGG + Intergenic
1155229205 18:23757047-23757069 GAGGGCACAGACGCCCAGCCTGG - Intronic
1160033350 18:75281057-75281079 GAGGGTCCAGACGCCCTGCCTGG + Intronic
1160876650 19:1299693-1299715 GAGGGAGCAGAGGGCCTGCCTGG + Intronic
1161977121 19:7612996-7613018 GAGGAGCCAGCCGCCCGGCCGGG + Exonic
1163587950 19:18174003-18174025 GAGGGAACAGGCGCCCTGTCGGG + Intronic
1163916858 19:20247606-20247628 CAGGGTCCAGCCGTTCTGCCAGG + Intergenic
1165830806 19:38729355-38729377 CAGGGCCCTGACGCCGTGCCCGG + Exonic
929760905 2:44805544-44805566 GAGGGCCAGGACTCCCTGCCGGG + Intergenic
929810786 2:45187904-45187926 GAGGGTGCAGGCAGCCTGCCGGG - Intergenic
932657959 2:73626658-73626680 GAGGGACCAGCTGCCCTGACTGG - Intergenic
932664637 2:73686997-73687019 GAGGGGCCAGCTGCCCTGACTGG - Intergenic
932882417 2:75516063-75516085 GAGGGGCCAGGGGCCCTGCGGGG + Intronic
934714060 2:96533180-96533202 GAGGGGCCTGAGGCCCTGACAGG + Intergenic
936400295 2:112159814-112159836 GTGGGCCCAGATGCCCTTCCAGG + Exonic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
938398375 2:130967149-130967171 GCGAGTCTAGAGGCCCTGCCTGG - Intronic
946018246 2:216621204-216621226 GAGGGTCCCCACTCCCTCCCAGG - Intergenic
948488660 2:238297409-238297431 GAGGATTCAGAGGCCCTGCCGGG - Intergenic
1169198732 20:3697393-3697415 AGGGGTCCAGCCGCCCAGCCTGG + Intronic
1173553397 20:43948813-43948835 GAGGTTCCCGAGGCCCTCCCTGG - Intronic
1175504077 20:59469712-59469734 GAGGGTCCAAGCGCCTTGCATGG - Intergenic
1175838493 20:62011777-62011799 GAGCGTCCAGGCCCACTGCCTGG + Intronic
1176238821 20:64066610-64066632 GAGGGTGGGGAAGCCCTGCCAGG - Intronic
1176363305 21:6016706-6016728 GAGGCTGCAGACCCTCTGCCAGG - Intergenic
1177177990 21:17719440-17719462 GGGGGTTCAGCCCCCCTGCCCGG - Intergenic
1177212709 21:18090364-18090386 GCTGGTCAAGAAGCCCTGCCAGG + Intronic
1179575288 21:42304782-42304804 GAGTGGCCAGGAGCCCTGCCTGG - Intergenic
1179760213 21:43521839-43521861 GAGGCTGCAGACCCTCTGCCAGG + Intergenic
1180131574 21:45830169-45830191 GAGGGGCCATTTGCCCTGCCTGG - Intronic
1183184038 22:36281800-36281822 GAGGGGCCAGCGGCCCTCCCAGG - Exonic
1183347410 22:37315439-37315461 GAGTGACCAGCCTCCCTGCCTGG - Intergenic
1183802264 22:40176810-40176832 GAGGGTCAAGAAGCCTTCCCAGG + Intronic
1183975005 22:41506945-41506967 GCGGGTCCACTCTCCCTGCCAGG - Intronic
1184194635 22:42918738-42918760 GAGGCTCCAGCCTCCCTGGCAGG - Intronic
1184257174 22:43293988-43294010 CAAGGCCCAGCCGCCCTGCCAGG - Intronic
1184511240 22:44934529-44934551 GATGGACCTGACGCCCTGGCAGG - Intronic
1184784656 22:46665852-46665874 GAGGGGGCAGCCGCCCTGCCTGG - Intronic
1185030777 22:48441786-48441808 GTGGGTCCAAGCCCCCTGCCTGG + Intergenic
950880086 3:16316518-16316540 GATGGTCCAGACCCTCTGGCTGG + Exonic
952873219 3:37920541-37920563 GAGGCTGCAGAGGCCCTGCCAGG + Intronic
953414071 3:42705585-42705607 GAGGGTGCAGGTGCCCTGGCGGG - Intronic
955227599 3:57073857-57073879 CAGGGTCCAGGTGTCCTGCCAGG + Exonic
956788390 3:72661397-72661419 GAAGGTCCAGGTGTCCTGCCTGG - Intergenic
957445189 3:80307703-80307725 GATGGTCCAGATGCCTTTCCTGG - Intergenic
957731338 3:84141451-84141473 GAGGCGCCAGCCGCCATGCCCGG - Intergenic
959454491 3:106541793-106541815 GAGAGGCCAGAAGCCCTGGCTGG - Intergenic
960961037 3:123070555-123070577 GAGGGCACAGACACCCAGCCTGG - Intronic
963283667 3:143412240-143412262 GAGAGTCCAGAGGACCTGTCAGG - Intronic
968782776 4:2595572-2595594 CAAGGCCCAGACGCCCTTCCAGG - Intronic
968920242 4:3518717-3518739 GCGGCACCAGACGCCCTCCCAGG - Intronic
969672479 4:8597476-8597498 GACTGTCCAGACACCCTCCCTGG - Intronic
970449629 4:16154168-16154190 GAGAGTCCAGATGCAGTGCCTGG - Intergenic
972765695 4:42151342-42151364 GTGGGGCCAGACGCCCCCCCGGG - Intronic
975044353 4:69783474-69783496 GAGGGTGCATACACCCAGCCAGG - Intronic
979099744 4:116599534-116599556 CAGGGCCCTGACGCCGTGCCCGG + Intergenic
980333589 4:131440708-131440730 GAGTGGCCAGATGCCCTGGCTGG + Intergenic
983708556 4:170687631-170687653 CAAGGTCCAAACGTCCTGCCTGG + Intergenic
984239142 4:177196267-177196289 GAGGGTACATACTCCATGCCTGG + Intergenic
985520984 5:373823-373845 GGGGCTCCTGGCGCCCTGCCCGG + Intronic
985601585 5:837899-837921 GAGGGTCCAGATGGCCTGTGGGG + Intronic
985893010 5:2730756-2730778 GAGGGTGCAGAAGCCCTGAGTGG - Intergenic
986899290 5:12412524-12412546 GAGGGTCCAGAGGTGCTGTCAGG + Intergenic
987085227 5:14461613-14461635 GAGGGTCCAGAAGCCAAGTCTGG - Intronic
988482295 5:31640193-31640215 GAGGGTCCAGGACCCCTGGCAGG + Intronic
989734343 5:44685565-44685587 GAGTTTCCAGAGGCCTTGCCTGG + Intergenic
995189521 5:109305784-109305806 GAGGGTATAGCAGCCCTGCCTGG + Intergenic
998159774 5:139806846-139806868 GGGGGCCCAGAGTCCCTGCCTGG - Intronic
998253354 5:140567210-140567232 CAGGGTCCAGCGGGCCTGCCTGG - Exonic
998374683 5:141682633-141682655 CAGGGTCCAGCCACCCTTCCGGG - Intergenic
999269129 5:150286313-150286335 GAGGCTCCAGTAGCCCTGCCTGG + Intronic
999326602 5:150648116-150648138 GAGGGGACAGAAGCCCAGCCAGG + Exonic
1001570228 5:172725924-172725946 AGGGGTCCAGCAGCCCTGCCTGG + Intergenic
1002711083 5:181195397-181195419 CAGGGCCCAGACGCCCTCCTCGG + Exonic
1004428413 6:15522317-15522339 GAGGGGACAGACTCCCCGCCGGG - Intergenic
1006513586 6:34534246-34534268 GAGGGTCCTGACACTCTGGCAGG + Exonic
1007262229 6:40571841-40571863 AAGTGTCCAGACTCCCAGCCTGG + Intronic
1007734932 6:43975875-43975897 GAGCTTCCAGAGGGCCTGCCTGG + Intergenic
1012474961 6:99607836-99607858 GAGAGTCCAGAGGCCCAACCGGG + Intronic
1018652545 6:166004191-166004213 GAGGGTGCTGACACCATGCCTGG + Intergenic
1019447116 7:1077008-1077030 GAGGGCCGAGACCCCCGGCCTGG + Intronic
1019492662 7:1322500-1322522 GAGGGTCCTGCCGCCCTCCGGGG - Intergenic
1019658064 7:2208452-2208474 CAGGGAACAGACACCCTGCCTGG + Intronic
1020088475 7:5324166-5324188 GAGGCTCCAGCAGCCCCGCCCGG + Intronic
1023849039 7:44140269-44140291 CAGGGTGCAGGCTCCCTGCCTGG + Intronic
1025205834 7:56992948-56992970 GAGGCTCCAGCAGCCCCGCCCGG - Intergenic
1025666106 7:63583990-63584012 GAGGCTCCAGCAGCCCCGCCCGG + Intergenic
1033230686 7:139595197-139595219 AAGGGTCCAGCAGCCTTGCCCGG - Intronic
1033588362 7:142790931-142790953 GAGTGTCCAGCAACCCTGCCTGG - Intergenic
1034162515 7:149003747-149003769 GAGGAGGCAGACGCCCTGCGTGG - Exonic
1035709769 8:1703887-1703909 GAATGTGCACACGCCCTGCCTGG + Exonic
1036688134 8:10925117-10925139 GTGGGGCCAGATGCCCTGCCAGG + Intronic
1040548851 8:48423045-48423067 GAGCTTCCAGGGGCCCTGCCTGG + Intergenic
1045342515 8:101267396-101267418 CAGGGTCATGAAGCCCTGCCTGG + Intergenic
1047916729 8:129591853-129591875 CAGGGTCCTGACCCCCTTCCAGG + Intergenic
1048424698 8:134312213-134312235 GAGGCTGCACACGCCCTGCTGGG - Intergenic
1049657667 8:143805887-143805909 GAGGGCCCTGAAGCCCAGCCAGG - Intronic
1052176724 9:25472089-25472111 GAGTGACCAGAGGCCCTGGCTGG + Intergenic
1052988804 9:34506574-34506596 GAGGATCCAACTGCCCTGCCTGG - Intronic
1053158577 9:35797314-35797336 GAGGATCCAGAAGCCCAGGCTGG + Intronic
1056942363 9:90966483-90966505 GAGGGTCCCGAGGCCCAGCCAGG + Intergenic
1057047554 9:91897920-91897942 GAGAGTGCAGTCCCCCTGCCTGG + Intronic
1060493361 9:124100788-124100810 GAGGGTGCAGACACCCTTCCTGG - Intergenic
1062194737 9:135266721-135266743 GAGGGAGCAGACGTCCTCCCAGG - Intergenic
1062423963 9:136497592-136497614 GAGGGTCCCCACGCCTGGCCTGG - Intronic
1062570028 9:137180700-137180722 CAGGGCCCTGACGCCGTGCCTGG - Intronic
1185701408 X:2233491-2233513 GAAGTTCCAGACGCCCGGCTGGG + Intronic
1186763290 X:12745601-12745623 CAGGGTCCATACCTCCTGCCAGG + Intergenic
1194370876 X:93070010-93070032 GTGGGTCCAGACATGCTGCCTGG - Intergenic
1200044422 X:153393506-153393528 GCGGGTCCAGAAGAACTGCCAGG + Intergenic
1200138185 X:153885048-153885070 GGGGGTCCAGATACCCTGTCGGG + Intronic