ID: 1160034091

View in Genome Browser
Species Human (GRCh38)
Location 18:75285440-75285462
Sequence TCTCCTAGCTTATGTTCCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160034091 Original CRISPR TCTCCTAGCTTATGTTCCTG AGG Exonic
900354462 1:2253588-2253610 CCTCCTCACTTTTGTTCCTGAGG + Intronic
901618768 1:10564067-10564089 TTTCCTATGTGATGTTCCTGAGG + Intronic
902537943 1:17132275-17132297 TCTCCTCACTTTGGTTCCTGGGG + Intergenic
904221379 1:28972706-28972728 TCTCCCACCTCACGTTCCTGTGG + Intronic
905196591 1:36283563-36283585 TCTCCTTGCTAATGTACTTGTGG - Intronic
906128438 1:43441892-43441914 TCTCCTAGCTCAGCTTCCTCAGG - Intronic
908080041 1:60567196-60567218 TGGCCTGGCTTATGTTCATGTGG - Intergenic
908393766 1:63706589-63706611 TCTCCCAGCTTCTGTACTTGTGG - Intergenic
909560738 1:77006818-77006840 TGGCCTAGCTCATGTTTCTGTGG + Intronic
911147278 1:94564930-94564952 TCACAGAGCTTATGTTCTTGAGG - Intergenic
911903007 1:103528756-103528778 TCTCCTAGCTTATTATCCTTTGG - Intronic
915033962 1:152907219-152907241 GCTCTTAGCTTATTTTCCAGTGG + Intergenic
915501124 1:156318552-156318574 ACTCCTACCTTATGTTCCCCTGG + Intronic
917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG + Intronic
918260519 1:182791317-182791339 TCTGCTTGCCTTTGTTCCTGTGG - Intronic
918352389 1:183670568-183670590 TATCCTAGCACTTGTTCCTGTGG + Intronic
924054746 1:240114372-240114394 TCTCCTTTCTTTTGTTCCAGAGG + Intronic
1064462083 10:15544834-15544856 TCTCCTGGCTTACTTGCCTGAGG + Intronic
1065298411 10:24298847-24298869 TCTCTCAGCTTCTTTTCCTGTGG - Intronic
1070172908 10:73946016-73946038 TCTGCTTGTTTATGTTCCTCTGG - Intergenic
1070660498 10:78302490-78302512 ACTCCTAGCTTAGGGTCCTGAGG + Intergenic
1071425283 10:85543213-85543235 TCTCCAAGCTCATGAGCCTGAGG - Intergenic
1072813919 10:98486261-98486283 TCTCCAAGATTATTTTTCTGTGG - Intronic
1073644039 10:105281263-105281285 TCTCGGAGCTTATGTTCATGGGG + Intergenic
1076231196 10:128821291-128821313 CCTCCAAGCCTGTGTTCCTGGGG + Intergenic
1076636201 10:131883831-131883853 TCTCCTAGCGTAGGTGCCTCTGG - Intergenic
1078012512 11:7583720-7583742 GCTCCTAACTGATCTTCCTGGGG - Intronic
1080213930 11:29819478-29819500 TCTCTTACCTTAGTTTCCTGAGG - Intergenic
1081732575 11:45381868-45381890 TGTCCTAGTTCATGTTCCCGTGG - Intergenic
1082855678 11:57804657-57804679 TCTCTGAGCTTACATTCCTGAGG - Exonic
1085762610 11:79255191-79255213 TGTCCAAGTTTATTTTCCTGTGG + Intronic
1091660294 12:2378240-2378262 TTTTCTAGCTTGTGTTTCTGGGG - Intronic
1094543414 12:31381192-31381214 TCTCATAGTTTATATTCCAGTGG - Intergenic
1096515750 12:52154243-52154265 TCTCCTACCTGATGTCTCTGAGG - Intergenic
1097216201 12:57415188-57415210 TCTCCTCCCTTATGTTTTTGAGG - Intronic
1098294392 12:68989727-68989749 TCTCCTTGGTTATGCTTCTGTGG + Intergenic
1098304063 12:69084517-69084539 TCGCCTAGTTTATTTTCTTGTGG - Intergenic
1098553150 12:71787029-71787051 GCACGTAGTTTATGTTCCTGAGG + Exonic
1103800091 12:123532588-123532610 TCCCCTAGCTTATGAACCTGTGG - Intronic
1104372876 12:128238712-128238734 TCTTCCAGCTTCTGGTCCTGGGG - Intergenic
1107158733 13:37200021-37200043 TTTCCTAGGTTATCTTCCAGGGG + Intergenic
1107264532 13:38537162-38537184 TATCTTTGCTTATGTTCATGTGG - Intergenic
1108065960 13:46577902-46577924 TCTCCTTGGTTCTGCTCCTGTGG + Intronic
1108147427 13:47493519-47493541 TCTACTACCTTATCTTCCTCTGG - Intergenic
1108700004 13:52935635-52935657 TCTCCTATCACATGTTCCTGTGG + Intergenic
1113099615 13:106703180-106703202 TCTTCTAGTTTCAGTTCCTGAGG + Intergenic
1113698145 13:112363437-112363459 TCTCCAAGCTTATCTTACTCTGG - Intergenic
1114270417 14:21097639-21097661 CCTTCTGGCTTATCTTCCTGGGG - Intronic
1114577112 14:23725516-23725538 TCTCCTGGCTCAGGTTTCTGAGG + Intergenic
1115397654 14:32926863-32926885 TCTCCTAGTTTTTATTTCTGCGG - Intergenic
1119328006 14:73773522-73773544 TCTCCAAGCTGATCTTCCAGGGG + Intronic
1121147846 14:91601317-91601339 TTTCCTATCTTGTATTCCTGTGG - Intronic
1122428387 14:101624668-101624690 TCTCTGAGCCTTTGTTCCTGAGG - Intergenic
1202836587 14_GL000009v2_random:81797-81819 TCTCATGGCTTATCTTACTGAGG - Intergenic
1127080547 15:55374500-55374522 TCTCCTGACTTATATTCTTGTGG - Intronic
1130570317 15:85036900-85036922 TCTGCTAGCTGCTGTTTCTGAGG - Intronic
1132000458 15:98174303-98174325 TCTCATAGCTTTTTGTCCTGTGG - Intergenic
1144188893 17:12824947-12824969 TCTCTTATTTTATGTTCTTGTGG + Intronic
1144502922 17:15805226-15805248 TCTCCTACCTCAGCTTCCTGAGG + Intergenic
1144724591 17:17495568-17495590 TCTCCTTGGTTTTGTTCTTGAGG + Exonic
1144862968 17:18317313-18317335 TGTCCTCGCTGATGGTCCTGTGG - Exonic
1147384953 17:40075559-40075581 TCTCCCAGCTTAGGCTTCTGTGG + Intronic
1150825039 17:68466718-68466740 TCTCCTATCTTATGTTAATGTGG + Intergenic
1151090272 17:71431439-71431461 TCTCCTGGGTAATGTTCCTAGGG - Intergenic
1152905358 17:82967501-82967523 TCTCCAAACAAATGTTCCTGGGG - Intronic
1153885425 18:9460095-9460117 TAACCTATCTTATTTTCCTGAGG - Intergenic
1154103355 18:11498022-11498044 TGTCCTAGGTTTTTTTCCTGAGG - Intergenic
1154310160 18:13261071-13261093 TCTCCTAGGTGATGGTGCTGTGG + Intronic
1155231367 18:23778336-23778358 TCTTGGAGCTTATATTCCTGTGG + Intronic
1155763414 18:29594643-29594665 TCTTCTTCCTTATCTTCCTGAGG - Intergenic
1156752383 18:40474688-40474710 CCTCCTAGCTTATTTTGCTTAGG - Intergenic
1157453107 18:47802550-47802572 TGTCCTTGCTCATGTCCCTGAGG - Intergenic
1158462374 18:57657747-57657769 TCTCTTGGCTTATGTGGCTGAGG + Intronic
1158677235 18:59531455-59531477 TCTCATAATTTTTGTTCCTGGGG - Intronic
1159382279 18:67675642-67675664 TCACATAGCTTATATTCTTGTGG - Intergenic
1160034091 18:75285440-75285462 TCTCCTAGCTTATGTTCCTGAGG + Exonic
1160372192 18:78383064-78383086 TCTCTTAGCTTCTGTTCCAAAGG + Intergenic
1163951409 19:20591241-20591263 TCTCCTACCTTAGCCTCCTGAGG + Intronic
1165359299 19:35325565-35325587 TCTCCTATGTTATCTTCCAGAGG + Intronic
1167002176 19:46752246-46752268 TCTTCCCGCTTCTGTTCCTGTGG - Intronic
1202636050 1_KI270706v1_random:45565-45587 TCTCGTGGCTTATCTTACTGAGG + Intergenic
926016637 2:9458755-9458777 TCCCCTGGCTTTTGTTCCTAGGG - Intronic
927750630 2:25666972-25666994 TCTCATAGAGTATGGTCCTGAGG - Intronic
931557308 2:63519272-63519294 TCTCCATGCCAATGTTCCTGCGG - Intronic
931579262 2:63755100-63755122 TCTCTTAGATTACTTTCCTGAGG - Intronic
932010950 2:67976950-67976972 GTTCTCAGCTTATGTTCCTGGGG - Intergenic
933292472 2:80453080-80453102 GCTGCTACCTGATGTTCCTGAGG + Intronic
933997682 2:87681868-87681890 TCTCTCTGCTTATGTGCCTGTGG + Intergenic
936296172 2:111269002-111269024 TCTCTCTGCTTATGTGCCTGTGG - Intergenic
937531473 2:122833411-122833433 TCTCTTAGGTTATGTTATTGTGG + Intergenic
937768901 2:125695705-125695727 TGTCCTGGCTAATGTTCCTTTGG + Intergenic
937928025 2:127182832-127182854 GCTCCTGGCTCATGTTTCTGTGG - Intergenic
941051635 2:160741055-160741077 TATACTAGCTTTTGTTCCTTGGG + Intergenic
941097773 2:161260129-161260151 CCTCCTACCTTAGCTTCCTGAGG + Intergenic
943245031 2:185435937-185435959 TCTCCTAGCTCAGCCTCCTGGGG + Intergenic
944289488 2:197989376-197989398 TCTCCTAGCTTGACTTTCTGAGG + Intronic
946255966 2:218442055-218442077 TCTCCTAACTGGTGTTCCTATGG - Intronic
946557098 2:220870931-220870953 TCTCTTTCCTTATGTTCCTGGGG - Intergenic
948242183 2:236446938-236446960 TCTCCCACCTCATGCTCCTGGGG + Intronic
1168763598 20:366754-366776 GCTCCTAGTTCATCTTCCTGGGG - Intronic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170527937 20:17260038-17260060 TCTCCTTGCCTTTGTTCATGTGG - Intronic
1171414423 20:24968022-24968044 AATACTAGCTTATGGTCCTGGGG - Intronic
1172842407 20:37909843-37909865 TCTCCTAGCTGCTGGTCCTGGGG + Intronic
1173014445 20:39212186-39212208 TCTCAGAGCTTATGTTCCAGTGG - Intergenic
1173468755 20:43305872-43305894 GCTCCTAGCTTCTATTCCTTGGG + Intergenic
1175395679 20:58659222-58659244 TCTCTTATTTTATTTTCCTGAGG + Intronic
1175400732 20:58698598-58698620 TCTGCTGCCTTTTGTTCCTGGGG + Intronic
1176875468 21:14122514-14122536 TCTCCTGGATTAGGTTGCTGAGG - Intronic
1177320785 21:19517083-19517105 TCTCCTACCTCATGCTCCAGAGG + Intergenic
1178319676 21:31595917-31595939 TCTCCCTGCTTGTGTTCCTGAGG + Intergenic
1180364667 22:11927670-11927692 TCTCGTGGCTTATCTTACTGAGG - Intergenic
1181963002 22:26636612-26636634 TTTCCTACCTTATGTTCCACAGG - Intergenic
950478200 3:13227442-13227464 TCTCGTAGCTCATGTTCTAGTGG + Intergenic
950968639 3:17164580-17164602 TCTCTTGGCGCATGTTCCTGGGG + Intronic
951462795 3:22969320-22969342 TATTCTAGCTTATGATTCTGAGG + Intergenic
953135876 3:40181314-40181336 TCTCCTAGGCTAGGTACCTGTGG + Intronic
954321979 3:49838480-49838502 TCTTGGAGCTTATGTTCCAGTGG - Intronic
954840719 3:53509131-53509153 TCTCCCAGCTGGGGTTCCTGTGG + Intronic
956725842 3:72155953-72155975 TCACAGAGCTTATGTTCCAGAGG + Intergenic
956754779 3:72373757-72373779 TCTGCTTGCTTTTGTGCCTGAGG - Exonic
959372309 3:105542873-105542895 ACTCCTTGCTTATGTTGCTTGGG + Intronic
967003512 3:185360553-185360575 TGGCCTAGCTGATGTTCCTGTGG + Intronic
968176921 3:196558493-196558515 TGTGGTAGCTTATGTGCCTGAGG - Intronic
968253143 3:197241341-197241363 TCTCTTAGCTTTTGTTTGTGTGG - Intronic
970380259 4:15500382-15500404 TATGGTAGATTATGTTCCTGTGG - Intronic
971189021 4:24409368-24409390 TCTCCTAGCTGAGATTCCTTTGG + Intergenic
972667232 4:41178483-41178505 TCTCCTGGCTTTTGTTCTAGTGG - Intronic
973094287 4:46177616-46177638 TCTCATAGAGTATGTTTCTGGGG - Intergenic
973724176 4:53755941-53755963 TCTCTTAGCTTCTGTTTGTGTGG - Intronic
975176187 4:71291885-71291907 TCTCCTAGTTTTTATTTCTGTGG + Intronic
980101094 4:128542268-128542290 ACTCCTAGCTTAGGTTTCAGTGG - Intergenic
981214430 4:142147878-142147900 TCTCCTGGCTTATGGTTCAGAGG - Intronic
983630920 4:169848442-169848464 TCTCCTTGTTTATGTTCCTGTGG + Intergenic
984958520 4:185070619-185070641 TATCCTAAGTTATTTTCCTGAGG - Intergenic
996657947 5:125964348-125964370 TCTCCTAACTTATAATGCTGTGG + Intergenic
996759910 5:126976656-126976678 TCTCCTATCTCCTGTTTCTGAGG + Intronic
999918239 5:156287424-156287446 TCTCCTTGTTTCTGTTCCTTCGG - Intronic
1000682447 5:164202568-164202590 CCTTCTAGCTTATGTTTTTGGGG - Intergenic
1001095866 5:168775144-168775166 TCTCCTGGCTCAGGCTCCTGAGG + Intronic
1005244060 6:23861776-23861798 TTTCCTGGTGTATGTTCCTGTGG - Intergenic
1007317964 6:41004533-41004555 TCTCTTGGCTTTTATTCCTGAGG + Intergenic
1007607182 6:43125460-43125482 TCTCCCAGCTTGGGTTTCTGTGG + Intronic
1007955665 6:45915641-45915663 TCTCCCATGTTATGTTCCTTTGG - Intronic
1008469163 6:51863779-51863801 TCTCCTAGGACATGTTCATGAGG - Intronic
1009603280 6:65832220-65832242 TCTCCTAGGCTTTGTTTCTGAGG - Intergenic
1009725430 6:67531336-67531358 ACTCCCAGCTTGTGTTCCTCTGG - Intergenic
1009893862 6:69722228-69722250 TCTCTTAGCTTTTGTTTCTCTGG - Intronic
1010302965 6:74282904-74282926 TTTTAGAGCTTATGTTCCTGTGG + Intergenic
1011887284 6:92112288-92112310 TCCCAGAGCTTATATTCCTGAGG + Intergenic
1013051919 6:106544384-106544406 TCTCTTAGGTTATTTTCTTGGGG + Intronic
1013163286 6:107566771-107566793 TATTCTAGCTTACGTTCCTGAGG + Intronic
1014956727 6:127628525-127628547 TCTCCTGCCTCAGGTTCCTGAGG + Intergenic
1016556329 6:145342222-145342244 TCTCTTAGCTAATGTTCAAGAGG + Intergenic
1018229956 6:161665967-161665989 CCTCCTGGCTCAGGTTCCTGGGG + Intronic
1019650939 7:2158000-2158022 TCTCCGAGCTGAGGCTCCTGAGG - Intronic
1019808223 7:3144617-3144639 CCTCCTAGTTAATATTCCTGAGG + Intronic
1019812874 7:3177304-3177326 TCTCCTACCTTCTGACCCTGTGG + Intergenic
1022112014 7:27237638-27237660 TCTCCTACCCTACATTCCTGAGG + Intergenic
1023336836 7:39179395-39179417 TCTCCTAGCTAGGGTTGCTGTGG + Intronic
1023653365 7:42393362-42393384 TCTCCAAGCCTTTGTTCCTAAGG - Intergenic
1024026220 7:45412209-45412231 TCTCCTTGATTTTGTTCATGTGG + Intergenic
1024732521 7:52268732-52268754 TCTCCTAGCTTGCCTTCCTAGGG - Intergenic
1026350098 7:69508189-69508211 TCTCCTACCTTAGCCTCCTGAGG - Intergenic
1026527111 7:71163591-71163613 TCTTCTAGTTTAGATTCCTGTGG + Intronic
1028586833 7:92460390-92460412 TCTCCTGGCTTATATTTCTTGGG - Intergenic
1030258345 7:107536595-107536617 TGTCCTATCTTATTTTCTTGAGG - Intronic
1033573884 7:142661190-142661212 TTTCCTAGGTTATCTTCCAGGGG + Intergenic
1035257084 7:157637326-157637348 TCTCCTAGAATATGTTAGTGTGG - Intronic
1036217914 8:6896315-6896337 TCTTCTGGCTTCTGTTCCTGTGG + Intergenic
1038936829 8:32261125-32261147 TCTTCTAGCTTATGCTAATGTGG + Intronic
1040910980 8:52518703-52518725 TCTCCTGGTTTCTGTTTCTGTGG + Intergenic
1041159258 8:55021161-55021183 TATCTTAGTATATGTTCCTGGGG - Intergenic
1041454978 8:58049165-58049187 TCTCATATATTATGTTTCTGGGG + Intronic
1041936549 8:63338375-63338397 TCTCCTAGAATATGCTGCTGGGG + Intergenic
1043740583 8:83806124-83806146 TCTTCTAACTTCTATTCCTGTGG - Intergenic
1043793506 8:84504883-84504905 TCTCCCAGCTTGTGACCCTGGGG - Intronic
1044093093 8:88026928-88026950 TCTCAGTGCTGATGTTCCTGTGG + Intergenic
1044360200 8:91274214-91274236 TATCCTAGTTTATGTTCTAGTGG - Intronic
1047677969 8:127223679-127223701 ACTCATAGCTTTTTTTCCTGTGG - Intergenic
1048731010 8:137441262-137441284 TCTCCTAGTCTGAGTTCCTGAGG - Intergenic
1050108427 9:2189824-2189846 TCTGTTAGCTTATGTTTCTGTGG + Intronic
1052886476 9:33653589-33653611 TTTCCTAGGTTATCTTCCAGGGG + Intergenic
1056304164 9:85272879-85272901 TCTCCTATATTCTTTTCCTGTGG - Intergenic
1056627925 9:88269416-88269438 TCTCCTAGCTTGGCTTCCCGCGG + Intergenic
1058444821 9:105045472-105045494 TCTGCAAGGTTATGGTCCTGAGG + Intergenic
1203544123 Un_KI270743v1:116305-116327 TCTCGTGGCTTATCTTACTGAGG + Intergenic
1192841374 X:74859448-74859470 TCTCTTAGCTTTTGTTTGTGTGG - Intronic
1193573247 X:83171402-83171424 TCTCCAAGCTGATTTTCATGTGG + Intergenic
1193701281 X:84764637-84764659 TTTCCTAGGTTATCTTCCAGAGG + Intergenic
1194757562 X:97755300-97755322 TCTTTTAGATTTTGTTCCTGGGG + Intergenic
1194782493 X:98042134-98042156 TATCCTCTCTAATGTTCCTGGGG + Intergenic
1196360314 X:114847109-114847131 TCACCTAGCTAATGTTTTTGAGG - Intronic
1197794362 X:130284086-130284108 TCTCCTGGCTTAGGTGCCAGGGG + Intergenic
1200396304 X:155990633-155990655 TCTCTCAGCTTTTGTTTCTGTGG - Intergenic
1201791432 Y:17845496-17845518 TCTCCTCTCTTAGCTTCCTGAGG + Intergenic
1201799334 Y:17938146-17938168 TCTCCTGTCTTAGCTTCCTGAGG + Intergenic
1201802219 Y:17967810-17967832 TCTCCTGTCTTAGCTTCCTGAGG - Intergenic
1201810122 Y:18060493-18060515 TCTCCTCTCTTAGCTTCCTGAGG - Intergenic
1202353045 Y:24015147-24015169 TCTCCTCTCTTAGCTTCCTGAGG + Intergenic
1202362208 Y:24122500-24122522 TCTCCTGTCTTAGCTTCCTGAGG - Intergenic
1202362865 Y:24130596-24130618 TCTCCTGTCTTAGCTTCCTGAGG + Intergenic
1202507913 Y:25539519-25539541 TCTCCTGTCTTAGCTTCCTGAGG - Intergenic
1202508571 Y:25547615-25547637 TCTCCTGTCTTAGCTTCCTGAGG + Intergenic
1202517734 Y:25654968-25654990 TCTCCTCTCTTAGCTTCCTGAGG - Intergenic