ID: 1160034486

View in Genome Browser
Species Human (GRCh38)
Location 18:75287657-75287679
Sequence GTCCATCATGAACACCCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160034483_1160034486 5 Left 1160034483 18:75287629-75287651 CCTTCATCAACCCGCTGAGCGCT 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1160034486 18:75287657-75287679 GTCCATCATGAACACCCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 100
1160034484_1160034486 -5 Left 1160034484 18:75287639-75287661 CCCGCTGAGCGCTTTGCAGTCCA 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1160034486 18:75287657-75287679 GTCCATCATGAACACCCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 100
1160034485_1160034486 -6 Left 1160034485 18:75287640-75287662 CCGCTGAGCGCTTTGCAGTCCAT 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1160034486 18:75287657-75287679 GTCCATCATGAACACCCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 100
1160034481_1160034486 15 Left 1160034481 18:75287619-75287641 CCGGAGCCTTCCTTCATCAACCC 0: 1
1: 0
2: 1
3: 22
4: 207
Right 1160034486 18:75287657-75287679 GTCCATCATGAACACCCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 100
1160034482_1160034486 9 Left 1160034482 18:75287625-75287647 CCTTCCTTCATCAACCCGCTGAG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1160034486 18:75287657-75287679 GTCCATCATGAACACCCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 100
1160034480_1160034486 22 Left 1160034480 18:75287612-75287634 CCACTCACCGGAGCCTTCCTTCA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 1160034486 18:75287657-75287679 GTCCATCATGAACACCCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160034486 Original CRISPR GTCCATCATGAACACCCACC TGG Exonic
900375491 1:2352616-2352638 GCCCACTAGGAACACCCACCTGG - Intronic
901060084 1:6467912-6467934 GTCCAGCCTGAGCCCCCACCAGG - Exonic
904915507 1:33967570-33967592 GTCCATGATGGTCACCCAACAGG + Intronic
908266269 1:62382201-62382223 GTGCATCAAGAACACCCATGGGG - Intergenic
909481648 1:76133149-76133171 ATCCATCAGGCACACCAACCAGG + Intronic
914355335 1:146879795-146879817 TTCCATCATGAACAACAGCCTGG + Intergenic
919542326 1:198864090-198864112 GTCAATCATTACCACCTACCAGG - Intergenic
921106954 1:211990995-211991017 GGCCATCATGACCACCTGCCTGG - Intronic
924152095 1:241140023-241140045 GGCCATCAGGAACATCCAGCAGG - Intronic
1065700150 10:28417086-28417108 GTCCCTCCTGAACACTGACCTGG - Intergenic
1066247410 10:33596660-33596682 GTCCAGCATGAACACCCCGGAGG - Intergenic
1069884609 10:71615832-71615854 ATCCATCATCAACAACCACACGG + Intronic
1070160369 10:73863242-73863264 GTTCAGCATGACCACCGACCAGG + Intronic
1073399628 10:103246023-103246045 GTCCATCCTCAACAGCGACCTGG + Exonic
1075145137 10:119876310-119876332 GACCTTCATGAACACTCCCCTGG - Intronic
1078431535 11:11292137-11292159 GTCCACCATGTACAGCCCCCAGG + Intronic
1078549686 11:12271507-12271529 GTCCAGAGAGAACACCCACCAGG - Intergenic
1078628365 11:12979265-12979287 GTCCATCATGACCACATAGCTGG - Intergenic
1079176080 11:18142275-18142297 GTCCCGCATGAGCAGCCACCTGG - Intronic
1079179575 11:18178000-18178022 GTCCTGCATGAGCAGCCACCTGG - Intronic
1080112169 11:28580763-28580785 GTCCTTTATGAACACTCAGCAGG - Intergenic
1085251570 11:75147478-75147500 GTGCAACCTGGACACCCACCCGG + Intronic
1085324867 11:75598853-75598875 TTCCATCATGAAGACACACAGGG + Intronic
1090227518 11:125080610-125080632 GCCCATGATGAACCCCCGCCTGG - Exonic
1091599157 12:1907684-1907706 GCCCACCAGGCACACCCACCAGG - Intronic
1091599185 12:1907787-1907809 GCCCACCAGGCACACCCACCAGG - Intronic
1093338247 12:17936722-17936744 TTCCATCAAGGAAACCCACCAGG + Intergenic
1111460727 13:88538423-88538445 CTCAATCATGAACAGCCACAGGG + Intergenic
1112089934 13:96072501-96072523 GTTTATCATGAACAGCCACCTGG - Intergenic
1117128359 14:52657043-52657065 TTCCATGAGGCACACCCACCAGG + Intronic
1118843301 14:69528263-69528285 GTCCTTCATGACCTCCCAGCTGG + Exonic
1120960004 14:90115750-90115772 GTCCACCCTGAAAAACCACCTGG + Intronic
1124874573 15:33579907-33579929 GGCCCTGATGAACACCCACTGGG - Intronic
1127091055 15:55467913-55467935 GTCAATCATGTACACCAACTAGG - Intronic
1133230082 16:4362253-4362275 GTCCATGCTGTACATCCACCTGG - Intronic
1139978681 16:70835735-70835757 TTCCATCATGAACAACAGCCTGG - Exonic
1144516367 17:15919793-15919815 TTCCATCCTGTACACCCAGCTGG - Intergenic
1148647387 17:49226808-49226830 TTCCACCAGGAATACCCACCTGG + Intronic
1154161759 18:11985714-11985736 GTCCATCACGCCGACCCACCTGG - Intronic
1159016361 18:63104462-63104484 GTTCATCATCAACACGCACTTGG - Intergenic
1159952654 18:74496428-74496450 GTCCATCAGGAAGACCCACCTGG - Exonic
1160034486 18:75287657-75287679 GTCCATCATGAACACCCACCTGG + Exonic
1161067217 19:2244549-2244571 GTACTTCATGAAGAACCACCTGG + Exonic
1163647728 19:18499585-18499607 GTCCATCATTCACAGCCACACGG - Intronic
1164824827 19:31277593-31277615 GTCAGTCATGAACATTCACCTGG - Exonic
1165004282 19:32791891-32791913 GTCCACCATGAACAGACATCAGG + Intronic
1165358604 19:35319429-35319451 GCCCTGCATGATCACCCACCTGG - Intronic
929861443 2:45681492-45681514 GTGCATCATAAACGCCTACCTGG - Intronic
934619400 2:95794805-95794827 GTCCACCATGATCTCTCACCTGG - Intergenic
934641492 2:96029752-96029774 GTCCACCATGATCTCTCACCTGG + Intronic
936228605 2:110680148-110680170 GTTCAACATGAGCAGCCACCGGG - Intergenic
937988499 2:127649469-127649491 TGCCATCATCAGCACCCACCTGG + Intronic
945451784 2:210002688-210002710 GTCCATCCTCAACAGCGACCTGG + Exonic
946133715 2:217628383-217628405 TTCGATCATCATCACCCACCAGG + Intronic
947301969 2:228697768-228697790 CTCCACCATGAACATTCACCAGG - Intergenic
1169932185 20:10845927-10845949 GACCATTTTGAACTCCCACCAGG + Intergenic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1180633505 22:17246205-17246227 ATCCCTCATGCACACCTACCTGG + Intergenic
1182833837 22:33325533-33325555 GCCAATCATGAACACCCATGTGG + Intronic
1183315974 22:37136993-37137015 TTCCATCAAGAAAACCCAACGGG - Intronic
950072057 3:10160647-10160669 TTCCATGACCAACACCCACCAGG - Intergenic
952429925 3:33213491-33213513 CTCAAACATGAACACACACCAGG + Intronic
953136334 3:40185479-40185501 GTCCATCAGGAACACCCCTCGGG - Intronic
953845490 3:46423028-46423050 GTAGATCATGAACAGCCACTGGG - Intergenic
958532460 3:95350685-95350707 CTCCATCATGAATATCCATCTGG - Intergenic
961461575 3:127053379-127053401 GTCCCAAATGAAGACCCACCTGG - Intergenic
962490404 3:135888171-135888193 GTTCATCATGAACATGTACCAGG - Intergenic
965540387 3:169865820-169865842 CTCCCTCATGTCCACCCACCTGG - Intronic
966837519 3:184060206-184060228 GTCCATCCTGAGCCCCCATCTGG - Exonic
968752663 4:2398265-2398287 GCCCACCATGACCACCCATCGGG - Intronic
968864582 4:3199832-3199854 TTCCATGATCACCACCCACCCGG + Exonic
969502175 4:7559763-7559785 GTTCATCTTGTACAACCACCCGG - Intronic
970473145 4:16396337-16396359 GGCCATCAACAGCACCCACCAGG - Intergenic
975716057 4:77206653-77206675 GTCTCACATTAACACCCACCAGG - Intronic
981939065 4:150262345-150262367 ATCCATAGTGAACACACACCAGG + Intergenic
986641687 5:9878208-9878230 GTTCATCTTGAACACCATCCAGG + Intergenic
993816776 5:92558287-92558309 GCCAATCATAAAAACCCACCTGG - Intergenic
996485025 5:124023472-124023494 TTCCATCTTGCACACCCACTGGG + Intergenic
999972440 5:156878559-156878581 GTCCATCATGACCACACCACTGG - Intergenic
1005065571 6:21814493-21814515 GTCCATCATTAAGTCCGACCTGG - Intergenic
1007739038 6:44000097-44000119 GCCCTTCATGAACACCCACATGG - Intergenic
1012417443 6:99025536-99025558 GTAGATCATGAACAGCCACTGGG - Intergenic
1018804610 6:167249098-167249120 GGTCATCCTGAACACCCTCCAGG - Intergenic
1019600655 7:1882078-1882100 GTTCACCATGCACATCCACCAGG + Intronic
1022232397 7:28426976-28426998 GTCCTCCAGGAACACTCACCAGG - Intronic
1023542480 7:41280559-41280581 GTGCCTCATGAACATCCACCAGG - Intergenic
1023623561 7:42095629-42095651 GACCATCATTAACACTCACCTGG - Intronic
1024687168 7:51758596-51758618 ATCCTTCATGAACAGCCCCCTGG - Intergenic
1024985026 7:55187264-55187286 GACAATCATGAGCACCTACCCGG + Intronic
1030111941 7:106034320-106034342 TTCCCTAATGAACACTCACCTGG - Intergenic
1032098090 7:128949546-128949568 GGCCTTCATAAACACTCACCTGG + Intronic
1033453521 7:141482303-141482325 TTCCTCCCTGAACACCCACCTGG + Intergenic
1036928755 8:12932100-12932122 GTCCATCATGATAAGCCCCCGGG + Intergenic
1041249265 8:55918816-55918838 GCCCATCATGGGCACCCATCAGG - Intronic
1042932657 8:74029214-74029236 GTGCATCATGCAGAGCCACCTGG + Intergenic
1045935933 8:107678840-107678862 GTCCTTCATGAAAACACATCTGG - Intergenic
1053729199 9:41035367-41035389 GTCCATCATGAGAATCCACCTGG + Intergenic
1054699314 9:68396699-68396721 GTCCATCATGAGAATCCACCTGG - Intronic
1057279744 9:93701158-93701180 GTCAATCATGACCACCAACCTGG + Intergenic
1059212510 9:112526955-112526977 GTTCATCATAAACACCTCCCAGG - Intronic
1060345574 9:122812940-122812962 GTCCATCATGCCCAGCCACCTGG - Intronic
1061867027 9:133497506-133497528 GTCTGTCGTGAACACCCTCCAGG - Intergenic
1062682997 9:137793344-137793366 GTCCAGCATCACCAGCCACCAGG + Intronic
1189777958 X:44487161-44487183 TTCCATCCTGAGCTCCCACCAGG - Intergenic
1190062418 X:47219586-47219608 GTCCCCCATGAACACACACCGGG - Intronic
1192656622 X:73000808-73000830 GTCCCTCTTGGACACCAACCTGG + Intergenic
1192665498 X:73082193-73082215 GTCCCTCTTGGACACCAACCTGG - Intergenic
1194383473 X:93223588-93223610 TTTCATCATGAAAACCCTCCAGG + Intergenic
1194683852 X:96887271-96887293 GTTCATTTTGAACACCCACCTGG + Intronic
1200703110 Y:6419026-6419048 GTTCTTCATGAAACCCCACCTGG + Intergenic
1201031000 Y:9745681-9745703 GTTCTTCATGAAACCCCACCTGG - Intergenic
1201452576 Y:14132328-14132350 GACCATCATGAGCCACCACCCGG - Intergenic
1201557368 Y:15277044-15277066 GTCAATCATGACCATCCACTTGG - Intergenic