ID: 1160035285

View in Genome Browser
Species Human (GRCh38)
Location 18:75295782-75295804
Sequence ATCTGCAAGCAGAAATCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160035283_1160035285 30 Left 1160035283 18:75295729-75295751 CCATAATTTTTTTCATCAATTAG No data
Right 1160035285 18:75295782-75295804 ATCTGCAAGCAGAAATCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160035285 Original CRISPR ATCTGCAAGCAGAAATCTGA TGG Intergenic
No off target data available for this crispr