ID: 1160036004

View in Genome Browser
Species Human (GRCh38)
Location 18:75302366-75302388
Sequence GGATGCTACAAGTGTGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160036004_1160036007 -2 Left 1160036004 18:75302366-75302388 CCTTGATCACACTTGTAGCATCC No data
Right 1160036007 18:75302387-75302409 CCCTTCACCTTGGCCAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160036004 Original CRISPR GGATGCTACAAGTGTGATCA AGG (reversed) Intergenic
No off target data available for this crispr