ID: 1160036888

View in Genome Browser
Species Human (GRCh38)
Location 18:75309902-75309924
Sequence ATTTTCTCCTTTGATATCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160036884_1160036888 -3 Left 1160036884 18:75309882-75309904 CCTGTGTGTCCCTGCCACACATT No data
Right 1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG No data
1160036877_1160036888 29 Left 1160036877 18:75309850-75309872 CCGGCCTCTGCCGGTCTCCCTGT No data
Right 1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG No data
1160036881_1160036888 12 Left 1160036881 18:75309867-75309889 CCCTGTGGCTTTCTCCCTGTGTG No data
Right 1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG No data
1160036879_1160036888 25 Left 1160036879 18:75309854-75309876 CCTCTGCCGGTCTCCCTGTGGCT No data
Right 1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG No data
1160036880_1160036888 19 Left 1160036880 18:75309860-75309882 CCGGTCTCCCTGTGGCTTTCTCC No data
Right 1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG No data
1160036882_1160036888 11 Left 1160036882 18:75309868-75309890 CCTGTGGCTTTCTCCCTGTGTGT No data
Right 1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG No data
1160036883_1160036888 -2 Left 1160036883 18:75309881-75309903 CCCTGTGTGTCCCTGCCACACAT No data
Right 1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160036888 Original CRISPR ATTTTCTCCTTTGATATCTA CGG Intergenic
No off target data available for this crispr