ID: 1160038927

View in Genome Browser
Species Human (GRCh38)
Location 18:75326745-75326767
Sequence ATGCAAAGCAAGCAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160038922_1160038927 11 Left 1160038922 18:75326711-75326733 CCCACCTCAAGAATCTAGAAAAA No data
Right 1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG No data
1160038925_1160038927 7 Left 1160038925 18:75326715-75326737 CCTCAAGAATCTAGAAAAAAGGT No data
Right 1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG No data
1160038923_1160038927 10 Left 1160038923 18:75326712-75326734 CCACCTCAAGAATCTAGAAAAAA No data
Right 1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160038927 Original CRISPR ATGCAAAGCAAGCAGCAGGA AGG Intergenic
No off target data available for this crispr