ID: 1160040626

View in Genome Browser
Species Human (GRCh38)
Location 18:75342133-75342155
Sequence GCAGAGGGCAAGCTGGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160040626_1160040632 3 Left 1160040626 18:75342133-75342155 CCACTTGCCAGCTTGCCCTCTGC No data
Right 1160040632 18:75342159-75342181 GAGCATGTCTGCATCCCCAGGGG No data
1160040626_1160040636 17 Left 1160040626 18:75342133-75342155 CCACTTGCCAGCTTGCCCTCTGC No data
Right 1160040636 18:75342173-75342195 CCCCAGGGGTTATGTCACTGGGG No data
1160040626_1160040633 15 Left 1160040626 18:75342133-75342155 CCACTTGCCAGCTTGCCCTCTGC No data
Right 1160040633 18:75342171-75342193 ATCCCCAGGGGTTATGTCACTGG No data
1160040626_1160040631 2 Left 1160040626 18:75342133-75342155 CCACTTGCCAGCTTGCCCTCTGC No data
Right 1160040631 18:75342158-75342180 TGAGCATGTCTGCATCCCCAGGG No data
1160040626_1160040634 16 Left 1160040626 18:75342133-75342155 CCACTTGCCAGCTTGCCCTCTGC No data
Right 1160040634 18:75342172-75342194 TCCCCAGGGGTTATGTCACTGGG No data
1160040626_1160040630 1 Left 1160040626 18:75342133-75342155 CCACTTGCCAGCTTGCCCTCTGC No data
Right 1160040630 18:75342157-75342179 CTGAGCATGTCTGCATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160040626 Original CRISPR GCAGAGGGCAAGCTGGCAAG TGG (reversed) Intergenic
No off target data available for this crispr