ID: 1160040629

View in Genome Browser
Species Human (GRCh38)
Location 18:75342149-75342171
Sequence TGCAGACATGCTCAGAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160040629_1160040636 1 Left 1160040629 18:75342149-75342171 CCTCTGCTCTGAGCATGTCTGCA No data
Right 1160040636 18:75342173-75342195 CCCCAGGGGTTATGTCACTGGGG No data
1160040629_1160040639 19 Left 1160040629 18:75342149-75342171 CCTCTGCTCTGAGCATGTCTGCA No data
Right 1160040639 18:75342191-75342213 TGGGGTGTGTGCCTTCCACTCGG No data
1160040629_1160040633 -1 Left 1160040629 18:75342149-75342171 CCTCTGCTCTGAGCATGTCTGCA No data
Right 1160040633 18:75342171-75342193 ATCCCCAGGGGTTATGTCACTGG No data
1160040629_1160040634 0 Left 1160040629 18:75342149-75342171 CCTCTGCTCTGAGCATGTCTGCA No data
Right 1160040634 18:75342172-75342194 TCCCCAGGGGTTATGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160040629 Original CRISPR TGCAGACATGCTCAGAGCAG AGG (reversed) Intergenic
No off target data available for this crispr