ID: 1160040632

View in Genome Browser
Species Human (GRCh38)
Location 18:75342159-75342181
Sequence GAGCATGTCTGCATCCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160040627_1160040632 -4 Left 1160040627 18:75342140-75342162 CCAGCTTGCCCTCTGCTCTGAGC No data
Right 1160040632 18:75342159-75342181 GAGCATGTCTGCATCCCCAGGGG No data
1160040626_1160040632 3 Left 1160040626 18:75342133-75342155 CCACTTGCCAGCTTGCCCTCTGC No data
Right 1160040632 18:75342159-75342181 GAGCATGTCTGCATCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160040632 Original CRISPR GAGCATGTCTGCATCCCCAG GGG Intergenic
No off target data available for this crispr