ID: 1160040633

View in Genome Browser
Species Human (GRCh38)
Location 18:75342171-75342193
Sequence ATCCCCAGGGGTTATGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160040628_1160040633 0 Left 1160040628 18:75342148-75342170 CCCTCTGCTCTGAGCATGTCTGC No data
Right 1160040633 18:75342171-75342193 ATCCCCAGGGGTTATGTCACTGG No data
1160040629_1160040633 -1 Left 1160040629 18:75342149-75342171 CCTCTGCTCTGAGCATGTCTGCA No data
Right 1160040633 18:75342171-75342193 ATCCCCAGGGGTTATGTCACTGG No data
1160040626_1160040633 15 Left 1160040626 18:75342133-75342155 CCACTTGCCAGCTTGCCCTCTGC No data
Right 1160040633 18:75342171-75342193 ATCCCCAGGGGTTATGTCACTGG No data
1160040627_1160040633 8 Left 1160040627 18:75342140-75342162 CCAGCTTGCCCTCTGCTCTGAGC No data
Right 1160040633 18:75342171-75342193 ATCCCCAGGGGTTATGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160040633 Original CRISPR ATCCCCAGGGGTTATGTCAC TGG Intergenic
No off target data available for this crispr