ID: 1160044375

View in Genome Browser
Species Human (GRCh38)
Location 18:75373099-75373121
Sequence AGGTGAGCCCAGGCCTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160044369_1160044375 14 Left 1160044369 18:75373062-75373084 CCCTGGTCTCAACTGTGCTCACT No data
Right 1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG No data
1160044368_1160044375 15 Left 1160044368 18:75373061-75373083 CCCCTGGTCTCAACTGTGCTCAC No data
Right 1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG No data
1160044370_1160044375 13 Left 1160044370 18:75373063-75373085 CCTGGTCTCAACTGTGCTCACTC No data
Right 1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160044375 Original CRISPR AGGTGAGCCCAGGCCTGCTC AGG Intergenic
No off target data available for this crispr