ID: 1160048471

View in Genome Browser
Species Human (GRCh38)
Location 18:75409139-75409161
Sequence AGCTTGAGTGCTTCCCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160048471 Original CRISPR AGCTTGAGTGCTTCCCACAA AGG (reversed) Intronic
900736326 1:4301609-4301631 GGCCAGAGTCCTTCCCACAATGG + Intergenic
902463666 1:16600767-16600789 TGCATGAGTTCTTCCCACCATGG + Intronic
903999136 1:27328480-27328502 AGCTTGAGCGCTTGAGACAATGG - Intronic
907038711 1:51238647-51238669 AGCTTGCTTGCTTCACTCAAAGG - Intronic
908423344 1:63981027-63981049 AGCATGAGTGATTCAGACAAAGG - Intronic
913372419 1:118115676-118115698 AGGCAGAGTGCTTCCCACGATGG + Intronic
919845824 1:201641577-201641599 GGCTAGAGGGCTTTCCACAAAGG + Intronic
1063591000 10:7395326-7395348 ATCTTGAGGGCTTCCCTCCATGG + Intronic
1068956738 10:62825140-62825162 AGATTGTGTGCTTCCCTCTAAGG + Intronic
1069900504 10:71704100-71704122 AGCTTGAATGCTTTCCAGGACGG - Intronic
1077693411 11:4370357-4370379 GGCATAAGTGCTTCCCTCAAGGG - Intergenic
1079627651 11:22634930-22634952 AGCCAGAGTGATGCCCACAATGG + Intronic
1081046624 11:38281513-38281535 AGCATTACTGCTTTCCACAATGG - Intergenic
1084599596 11:70136972-70136994 AGCTTGAATGCTTCCCAGCACGG - Intronic
1090188449 11:124752885-124752907 AGCTTGAGTGCTCCCGGCTAGGG - Intronic
1094287487 12:28811696-28811718 TGCCTGACTGCTGCCCACAAGGG + Intergenic
1097052835 12:56233774-56233796 AGCTTGAATGCTTCCTGCAATGG - Intronic
1097740021 12:63230914-63230936 CGCCAGACTGCTTCCCACAATGG - Intergenic
1097915088 12:65012860-65012882 AAGTTGAGTGCTTCCCAAATAGG - Intergenic
1098352186 12:69574497-69574519 AGCTTGCGGGCTTCCCAAACAGG - Exonic
1101290226 12:103360824-103360846 AGCATTAGTGATTCCCCCAAAGG - Intronic
1101672200 12:106885953-106885975 TGGTTGAGTGCTTCCTCCAAAGG - Exonic
1101816675 12:108151039-108151061 AGCTCGAGTGCTGACCACACTGG - Intronic
1104515975 12:129427068-129427090 AGCATGTGTGCTTCCCATATGGG - Intronic
1109110683 13:58315756-58315778 AGCTTGAGTTTTTCCAACAGTGG - Intergenic
1112495729 13:99902792-99902814 AGCTGGAGTGCTTCCCAATGGGG - Intergenic
1120480914 14:85047958-85047980 AGCTACACTGCTTTCCACAATGG + Intergenic
1120727636 14:87962781-87962803 AGCTTGAGATCTCCCCACACTGG + Intronic
1122169824 14:99863173-99863195 AGTAAGGGTGCTTCCCACAAAGG - Intronic
1124579283 15:30938558-30938580 AGCCTGAGACCCTCCCACAATGG - Intronic
1124692770 15:31839218-31839240 AACTGGATTGCTTCCCACAGTGG + Intronic
1124927511 15:34085621-34085643 AGCTTGAGCTTTTCCCACAAAGG + Intronic
1125078216 15:35645789-35645811 TGCCTGACTGCTTTCCACAATGG - Intergenic
1127741816 15:61915257-61915279 TGCCTGAGTGCTTCACACATAGG + Intronic
1127860102 15:62986835-62986857 AATTTGTGTGCTTCCCACTATGG - Intergenic
1131615816 15:94016410-94016432 CGCCATAGTGCTTCCCACAATGG - Intergenic
1141204994 16:81926615-81926637 AACGTGAGTGCTTCCCTCAGAGG - Intronic
1150454826 17:65298867-65298889 AGCTTGAGTTCATTCCACTAGGG + Intergenic
1152452345 17:80389736-80389758 AGCCTGAGTGCTCTCCACACAGG - Intronic
1152740920 17:82018011-82018033 AGCTTTTGTGCTTCCCACCCTGG + Intergenic
1154479356 18:14802887-14802909 AGCTTGACTGCCTGCCACAAAGG - Intronic
1154480147 18:14813774-14813796 AGCTTGACTGCCTGCCACAAAGG - Intronic
1160048471 18:75409139-75409161 AGCTTGAGTGCTTCCCACAAAGG - Intronic
1160568421 18:79800583-79800605 ACCCTGAGTGCCTCCCACACGGG - Intergenic
1163648171 19:18502027-18502049 TGCTGGAGTGCGTCCCACAGAGG + Intronic
1164458228 19:28426791-28426813 TGCTTGACTGCCTCCCACACTGG - Intergenic
1167865652 19:52325344-52325366 CGCTGCAGTGCTTTCCACAATGG - Exonic
1202679327 1_KI270711v1_random:38207-38229 TGCATGAGTTCTTCCCACCATGG + Intergenic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
928305036 2:30162526-30162548 AGCCTCAGAGCTACCCACAAGGG + Intergenic
928466205 2:31525139-31525161 AGCCTGAATGCCTCCCTCAAAGG - Exonic
932033442 2:68214701-68214723 AGCTACACTGCTTCCCACAACGG - Intronic
932484414 2:72074430-72074452 AGCCTGGGTGCTGCCCACACTGG - Intergenic
933455310 2:82512185-82512207 TGCTAGACTGCTTTCCACAATGG - Intergenic
936785110 2:116085431-116085453 GGCTGGAGTGCTGCCTACAAGGG + Intergenic
936788799 2:116125659-116125681 AGCTTGAGTCATTGCCTCAAAGG - Intergenic
937255634 2:120553408-120553430 AGCTTACGTTCTTTCCACAAGGG - Intergenic
937701620 2:124868762-124868784 AGCTTGAGTGCAATCCACCAGGG - Intronic
938670612 2:133583032-133583054 AGCCTAATTGCTTCCCAGAAAGG - Intergenic
939431681 2:142117568-142117590 TGCTTTATTGGTTCCCACAATGG + Intronic
946069262 2:217017349-217017371 AGGTTCAGTGCTTCCAAAAAAGG + Intergenic
947163189 2:227235050-227235072 AGCCTGAGTCCTTCACCCAAGGG - Intronic
947424895 2:229974421-229974443 ATCTGCAGTGCTTGCCACAATGG - Intronic
948592597 2:239060826-239060848 AGCCTGCGTGCATCCCACACGGG - Intronic
948652613 2:239457860-239457882 AGCCTGAGTGGCTCCCACACTGG - Intergenic
1170000818 20:11611405-11611427 ACCTTAAGTGCCTCCCTCAAGGG - Intergenic
1170463169 20:16598341-16598363 AGCTTGGTTGCTTCCCAGAAAGG - Intergenic
1171253187 20:23666124-23666146 AGCCTGAGAGCTGCCCACTACGG + Intergenic
1171259675 20:23721451-23721473 AGCCTGAGAGCTGCCCACTACGG + Intergenic
1171268738 20:23796909-23796931 AGCCTGAGAGCTGCCCACTACGG + Intergenic
1176800393 21:13422516-13422538 AGCTTGACTGCCTGCCACAAAGG + Intergenic
1177038639 21:16077435-16077457 ACCTTGATTCTTTCCCACAAAGG - Intergenic
1178477987 21:32954600-32954622 GGCTTACGTGCTTCCTACAACGG - Intergenic
1182742213 22:32576201-32576223 GGCTTGAGGTCTTCCCACAGTGG + Intronic
1182755044 22:32672747-32672769 AGCTGGGGTGGTTCCCACATTGG + Intronic
954334240 3:49906908-49906930 AGCTGGAGTGGTCCACACAAGGG - Intronic
955977906 3:64495963-64495985 AAAGTGAGTGCTTCCCAGAAAGG + Intergenic
963020384 3:140868223-140868245 AGCTTGTGTCCTTCCCTTAAGGG + Intergenic
964524693 3:157606146-157606168 AGCTTGAATAGTACCCACAAAGG - Intronic
973592940 4:52460693-52460715 AGCCAGAGGGCTGCCCACAAAGG + Intergenic
973713202 4:53649809-53649831 TGCTTGTCTGCTTCCCACAGTGG + Intronic
975290883 4:72677462-72677484 AGCTGGAGTTTTTCCCACAGAGG - Intergenic
982719827 4:158848068-158848090 GGCTTGTGTCCTTCCCTCAAAGG - Intronic
987389007 5:17357920-17357942 CGCCAGAGTGCTTTCCACAATGG + Intergenic
990492324 5:56314736-56314758 TGCCTGAGTGCTTCCCCCTAGGG + Intergenic
990995096 5:61725119-61725141 TGCTTGAATGCTTCTCATAATGG - Intronic
993177997 5:84513301-84513323 AGCTACATTGCTTTCCACAATGG + Intergenic
995146831 5:108796439-108796461 AGCTTGTGTCCTTTCCTCAAGGG + Intronic
997769086 5:136536484-136536506 TGCTTGAGAGCTTCACACAATGG + Intergenic
1001535489 5:172495064-172495086 AGTTTGAGTGCTTCGCCTAAGGG + Intergenic
1001609473 5:172988667-172988689 AGCTGAAGTGCTTCACACTATGG + Intronic
1004306778 6:14508463-14508485 ACCTTCAGTTCTGCCCACAATGG + Intergenic
1005672810 6:28124512-28124534 AGCTTGAGTGCTTGCCTCCTCGG - Intergenic
1006691567 6:35892072-35892094 AGTATGACTGCTTCCCAAAAAGG + Intronic
1006879149 6:37323780-37323802 AGTTTGAATCCTTCACACAAGGG + Intronic
1006883429 6:37359249-37359271 AGCTTGAGAGCTTCCGGAAAAGG - Intronic
1012693411 6:102347330-102347352 TGCTGTACTGCTTCCCACAATGG - Intergenic
1013845361 6:114444175-114444197 TGCTTGAGTGGTTCCCAAACAGG + Intergenic
1015418009 6:132971604-132971626 AGGTTGAGTTTTTCCCACAAAGG - Intergenic
1020174173 7:5869204-5869226 AGCATGAGTGTTCCCCACGAGGG + Intergenic
1021243523 7:18234232-18234254 ATCTTGGATGCTTCCCTCAAGGG + Intronic
1026459097 7:70597638-70597660 AATTTCACTGCTTCCCACAAGGG - Intronic
1026946157 7:74317579-74317601 GGCTGGAGTGCTTCCCCCCACGG - Exonic
1027152697 7:75743852-75743874 CGCTTGAGTCCTTTCCACACAGG - Intergenic
1028420872 7:90631481-90631503 ATCTTAACTGCTTCCCAGAAAGG - Intronic
1032425669 7:131820403-131820425 CGCTTGAGGGCTGCTCACAAGGG + Intergenic
1032766799 7:135001720-135001742 AGCTTCAGGGTTTCCAACAAAGG - Intronic
1038127333 8:24689416-24689438 AACTTGAGTGTTTCCCACCCTGG + Intergenic
1039603917 8:38865454-38865476 AATTTGAGAACTTCCCACAAGGG + Intergenic
1044929296 8:97236441-97236463 AGCTTGAGTGGATGCCATAATGG - Intergenic
1048800047 8:138186844-138186866 ATCTTGTCTGTTTCCCACAATGG - Intronic
1049115152 8:140679862-140679884 AGCTGGAGTGTTTCACAAAATGG + Intronic
1058726267 9:107807629-107807651 TGGTAGAGTGCTTCCCTCAATGG + Intergenic
1058987136 9:110218956-110218978 AGCCTTTGTGCTTCCCAGAAGGG - Intergenic
1061147626 9:128809053-128809075 GGGTTGAGTGAGTCCCACAAAGG + Exonic
1203423775 Un_GL000195v1:19009-19031 TGCTTGGGTGCTGCCCACAGGGG - Intergenic
1192892395 X:75404798-75404820 TGCTATAGTGCTTTCCACAATGG - Intronic
1197269915 X:124414221-124414243 AGTGGGAGGGCTTCCCACAAAGG + Intronic
1198931529 X:141866527-141866549 GGCTTGATTGCTTTCCAAAAAGG - Intronic
1199358861 X:146893754-146893776 AGCTTGAGCTTTTCCCACAGCGG + Intergenic