ID: 1160049958

View in Genome Browser
Species Human (GRCh38)
Location 18:75423698-75423720
Sequence TGGGCTTGAGTCAGTGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160049958 Original CRISPR TGGGCTTGAGTCAGTGCTAT TGG (reversed) Intronic
902137828 1:14326044-14326066 TGGGCTTCAGACAGAGCTACAGG - Intergenic
902221784 1:14970797-14970819 TGGGCGTGGGTGAGTGCTAGAGG - Intronic
904610249 1:31721924-31721946 TGGGCTGGAGTCATTACTATGGG - Intergenic
905266116 1:36755423-36755445 TGGGCTTGATTCTGGGCAATGGG + Intergenic
905711967 1:40112901-40112923 TGGGCTTGAGACACTGCGCTGGG - Intergenic
907808856 1:57848625-57848647 TGTGTTTGAGTCATTGCTCTTGG - Intronic
908327984 1:63042569-63042591 TGGGCCTGAGCGAATGCTATAGG + Intergenic
910121172 1:83791995-83792017 TGGTCCTGAGTCAGAGCTTTAGG + Intergenic
911734826 1:101325421-101325443 TGGGCTTGATTCATTGCCTTGGG + Intergenic
911764818 1:101661682-101661704 GGCGCTTGAGTCTGTGGTATGGG + Intergenic
912553109 1:110497177-110497199 TAGGCTTAAGTCAGTGCCCTGGG + Intergenic
912721513 1:112024360-112024382 TGGGCTTGAGTCAATGTAACTGG - Intergenic
914975419 1:152356463-152356485 CAGGCTTGAGTCAGTCCTCTGGG - Exonic
915775722 1:158483769-158483791 TGGAGCTGAGTCAGGGCTATAGG + Intergenic
916273692 1:162970695-162970717 TGGGCTTGAGTCAGGGGATTTGG + Intergenic
918590151 1:186232027-186232049 TGGGCTTGGCTCTGTGCTACAGG - Intergenic
921000937 1:211042030-211042052 TAGGCATGAGTCAGTGCACTTGG + Intronic
923817492 1:237397328-237397350 TGGGCTTCAGTCACTCATATCGG - Intronic
1064930815 10:20624372-20624394 TGGGCATGAGTTAGTGTTTTAGG + Intergenic
1065737500 10:28767497-28767519 CTGGCTTGAGTCAGGGCCATTGG + Intergenic
1065911598 10:30311281-30311303 TGTCCTTGTGTCTGTGCTATTGG - Exonic
1074970057 10:118528706-118528728 TGGAATTGAGTCAGTACTCTTGG - Intergenic
1076439109 10:130467417-130467439 TGGGCTTGGGTGAGTGATAGGGG + Intergenic
1076744650 10:132506728-132506750 GGGGCTTGAGTCAGTGCTTTGGG + Intergenic
1077089291 11:771208-771230 TGGGTCTGAGTCAGTGCCATGGG + Intronic
1083914133 11:65728908-65728930 AGGGTTTGAGTCAGTTCTTTAGG - Intergenic
1086411803 11:86551338-86551360 TGGGCTGGAGTCAGAGGTAGTGG - Intronic
1086935702 11:92743569-92743591 TGGGCTGGATTCAGTGCCCTGGG - Intronic
1087895813 11:103584668-103584690 TGGGCCTAACTCAGTGCTCTTGG + Intergenic
1088915344 11:114223494-114223516 TGGGCTTGAGCCAGAGCTCCAGG - Intronic
1089794500 11:120969416-120969438 GGGGCAGGAGTCAGTGCTGTGGG + Intronic
1097112973 12:56675947-56675969 TGGGCTTGAGTCACTGCGCCTGG - Intronic
1106182646 13:27381814-27381836 CGGGCTTGAGTCTGTGATGTTGG - Intergenic
1106564050 13:30870399-30870421 AGGGCTGGAGTCAGTGCTGTGGG + Intergenic
1106564056 13:30870418-30870440 TGGGGTGGAGTCAGGGCTGTGGG + Intergenic
1107686545 13:42906141-42906163 TGGGCTCGAAGCAGAGCTATTGG - Intronic
1109207138 13:59495175-59495197 TGGGCTTGAGTTAGTGATTCCGG + Intergenic
1113541090 13:111110275-111110297 TGGGCTTGTGTCACAGCTAAGGG + Intergenic
1116794206 14:49372810-49372832 TGTGCTTTAGTGAGTGCTACTGG + Intergenic
1121723598 14:96129954-96129976 TGGGGTTGTGTCTGTGTTATGGG - Intergenic
1125049318 15:35278770-35278792 TGGGCTTGAGCCACTGCTCCTGG - Intronic
1126283250 15:46981033-46981055 TGGGCTAATGTCATTGCTATTGG + Intergenic
1127178102 15:56382924-56382946 TGGGCTTGACTCAGAGCCAGAGG - Intronic
1127271280 15:57403952-57403974 TGAGCATCAGCCAGTGCTATGGG - Intronic
1127454408 15:59144056-59144078 TGGGCTTGAGTCTGTGTGCTGGG + Intronic
1129385868 15:75195889-75195911 TGGGCTGGAGTCAGGGCTGCGGG + Intronic
1130649466 15:85754005-85754027 TGAGCTGGAGTCAGGGCTAGTGG - Intergenic
1131506809 15:93026713-93026735 TGGGCTAGAGTCAGTATTATCGG - Exonic
1134621140 16:15690313-15690335 TAGGCTTGAGCCAGTGCAACTGG + Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1138129433 16:54467030-54467052 TGGGCATGAGTCACAGCTGTCGG + Intergenic
1143355796 17:6327554-6327576 TGGTCTTGATTCAGTGTTACAGG + Intergenic
1144186308 17:12799438-12799460 TGGTTTTCAGTCAGTGCTAAAGG + Intronic
1146817916 17:35958942-35958964 AGGGGTTGAGACAGTGCTATTGG + Intergenic
1148772047 17:50072895-50072917 AGGGCTGGAGTCAGTGCCATGGG + Intronic
1153182001 18:2445796-2445818 TGGGCTTTAGTCACTCATATTGG - Intergenic
1155031758 18:21991113-21991135 TGGGCTGGAGGCAATGCTGTGGG - Intergenic
1158607584 18:58909581-58909603 TGAGCTTGAGGCAGTGCTGTGGG + Intronic
1159023094 18:63158946-63158968 TGGGCTGGAGGCAGTGGGATGGG - Intronic
1159672100 18:71234163-71234185 TGGACTTGATTTAGTGTTATTGG + Intergenic
1160049958 18:75423698-75423720 TGGGCTTGAGTCAGTGCTATTGG - Intronic
1160528122 18:79549000-79549022 GGGGGTTGAGTCAGTGGCATGGG + Intergenic
1165237514 19:34434391-34434413 TGGGCATGAGCCAGTGCTCCTGG + Intronic
1165956279 19:39503796-39503818 CGGGCTGGAGTCTGTGCTCTTGG - Intronic
1166198923 19:41223692-41223714 TGGGCCTGAGTCACTCCTCTGGG - Intronic
1166212087 19:41313287-41313309 TGGGCTGGAGACAGAGCTGTGGG - Intronic
1166458632 19:42966667-42966689 GGGGCTGGAGTGAGTGCTTTGGG + Intronic
1166475577 19:43121927-43121949 GGGGCTGGAGTGAGTGCTTTGGG + Intronic
927366266 2:22300452-22300474 TGGTCTTGAGTAAGTGCTGCTGG + Intergenic
927990382 2:27442934-27442956 TAGGCTTGAGTCAGGGAAATGGG + Intronic
930277800 2:49333885-49333907 TGGGCTTAATTCAGTGTCATGGG - Intergenic
931808448 2:65830565-65830587 TGGTCTTGAGTCAGACCTAGGGG + Intergenic
933175955 2:79173361-79173383 TGGGCTTTAGTCACTGAGATTGG - Intergenic
933835030 2:86239124-86239146 TGACCTTGAGTGAGTGCTGTGGG - Intronic
934164840 2:89284585-89284607 TGGGCTGGAGTCATAGGTATAGG - Intergenic
934202433 2:89897882-89897904 TGGGCTGGAGTCATAGGTATAGG + Intergenic
938049730 2:128157821-128157843 TGGGCTTGAGTGAGTGGCAATGG + Intronic
943175927 2:184474246-184474268 TGGGGAAGAGTGAGTGCTATAGG + Intergenic
945653290 2:212591746-212591768 GGGACTTGACTCAGTGGTATGGG + Intergenic
946110901 2:217415509-217415531 TGGGTTTGAGTCAGAGCAGTCGG + Intronic
946362200 2:219225722-219225744 TGGGCCTGAGACAGTCCTGTGGG - Intronic
1171139424 20:22728375-22728397 AGGGCTTGAGGCTGTGCTGTGGG - Intergenic
1175212530 20:57370035-57370057 TGAGCTAGTGTCAGTGCTAAGGG - Intronic
1179249640 21:39662088-39662110 TGGGATTGAGTCCATGTTATCGG + Exonic
1181492246 22:23267894-23267916 TGGGCTTGTGTCTGTGCAGTGGG + Intronic
1182519660 22:30878213-30878235 TGGCCTTGAGTCATTGACATTGG - Intronic
1184161847 22:42701673-42701695 TGGACCTGAGTCAGTGCTTATGG - Intronic
1184781382 22:46651356-46651378 TGGGCTGGAAACAGTGCCATGGG + Intronic
949204386 3:1420604-1420626 TGGGCTTGTGTCATCACTATGGG + Intergenic
950712738 3:14824502-14824524 TGCCCTTCAGTCAGGGCTATGGG - Intronic
951569870 3:24050576-24050598 AGGGCTTCAGTCAGTCCTTTGGG + Intergenic
952557554 3:34550416-34550438 TGGGTTTGAGTCAGAGGAATGGG - Intergenic
956163740 3:66380882-66380904 TGGGTTAGAGTCACTGCTGTGGG + Intronic
962106341 3:132394458-132394480 TGGGTTGGAGTCAGTGTTCTGGG - Intergenic
962747660 3:138409449-138409471 TGGATTTGAGTCAGAGCTAATGG - Intergenic
963263732 3:143218439-143218461 TGTGGTTGGGTAAGTGCTATTGG + Intergenic
965679013 3:171231137-171231159 TGGCCTTGAGCCAGTACCATGGG - Intronic
969891159 4:10261149-10261171 GTGGCCTGAGTCAGTGCAATGGG + Intergenic
974471345 4:62322599-62322621 TGGGGTTGAGTCAGTGATATTGG + Intergenic
976770189 4:88643544-88643566 TGGGCTTTATTCTGTTCTATTGG - Intronic
976782159 4:88773127-88773149 TGTTCTTGAGTCAGTGATAGGGG - Intronic
980915818 4:139032377-139032399 TGGGCATGAGTCACGGCAATGGG - Intronic
984518740 4:180774863-180774885 TGGGCATGAGCCACTGCTCTTGG + Intergenic
985832900 5:2249128-2249150 TGGGCTGGAGCCAGTGGTATAGG - Intergenic
986304747 5:6506852-6506874 TGGCCCCGAGTCAGTGCTAAGGG - Intergenic
990000186 5:50883447-50883469 TTTGCTTGAATCAGTTCTATAGG - Intergenic
990986337 5:61644114-61644136 TGGGCTTGAGTGATAGATATAGG + Intronic
991414461 5:66378395-66378417 CAGGCATGAGTTAGTGCTATTGG - Intergenic
1007376416 6:41459908-41459930 TGGGCTTGAGTGTTTGCTCTGGG - Intergenic
1011874206 6:91936766-91936788 GGGGCTTCAGTCTGTGCAATTGG - Intergenic
1012864530 6:104602129-104602151 GGGGCATGAGACATTGCTATGGG + Intergenic
1022526712 7:31042773-31042795 TGGGGTTGAGTTAGTTCTTTGGG + Intergenic
1024160384 7:46668795-46668817 TGGGCTAGACTCTGTGCTAATGG - Intergenic
1030688815 7:112512025-112512047 TGGGCTGGAGTCATTGCCAGGGG + Intergenic
1034699223 7:153082273-153082295 TGGGCATGAGCCGCTGCTATGGG + Intergenic
1035362827 7:158324768-158324790 TGGTTCTGGGTCAGTGCTATGGG - Intronic
1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG + Intergenic
1037118584 8:15255924-15255946 TGGGCATGAGTCACTGCACTAGG - Intergenic
1037715442 8:21393391-21393413 TGGGCTTGGCGCAGTGCTCTTGG - Intergenic
1037943883 8:22974477-22974499 TGCGCTGGAGTGAGTGCTGTGGG - Intronic
1042329064 8:67558920-67558942 TGTGCATGAGTCAGTGAAATTGG + Intronic
1045333023 8:101172819-101172841 TGGCCTTGAGCCAGTATTATTGG - Intergenic
1045800585 8:106096659-106096681 TGGGCTAGAGTCAGTGGACTTGG + Intergenic
1045983618 8:108221286-108221308 TGGGCATGAGGCAATGCTCTGGG + Intronic
1046658091 8:116918604-116918626 TGATTTTGAGTCAGTGCTTTGGG - Intergenic
1047611716 8:126527327-126527349 TGGGCTTAAGTCTGTGCTATTGG + Intergenic
1048479834 8:134778917-134778939 TGGGCTTAACTCAGTGGTCTTGG + Intergenic
1053274398 9:36772282-36772304 TGCACTTGAGTAAGTGCTTTTGG - Intergenic
1055359892 9:75478352-75478374 TGGGCTTGAGCAAGAGCTCTGGG + Intergenic
1055856784 9:80697994-80698016 TGGACTTGAGTCAGTGTACTGGG - Intergenic
1057249746 9:93491192-93491214 TGGGGTTGGGTCAGTGGTGTGGG - Intronic
1057875338 9:98749298-98749320 GGGGCCTGAGGCAGTGCCATGGG - Intronic
1058011389 9:99981467-99981489 TGGGCCTGGGTTGGTGCTATAGG - Exonic
1058625332 9:106928103-106928125 TGGTGATGAGTCAGTGCTACTGG + Exonic
1058830171 9:108809329-108809351 TGGGCTTGAATCAGGTCTTTTGG - Intergenic
1059801826 9:117757689-117757711 TGGGCAGGAGTTAGTGCTGTAGG + Intergenic
1185916856 X:4045174-4045196 TGTGCGTGTGTCAGTGCTACTGG + Intergenic
1186175897 X:6925554-6925576 TGGGCTGTGGTCACTGCTATTGG - Intergenic
1186185172 X:7013727-7013749 GGGGCTGGAGTGAGTGCTTTGGG + Intergenic
1187358992 X:18606837-18606859 TGGGATTAAGTCAGTGCCAGTGG + Intronic
1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG + Intergenic
1191117177 X:56864483-56864505 TTGGTTTGGGTCAGTGCTAAAGG + Intergenic
1194662517 X:96642802-96642824 TGGGATTCAGTCAGTGAGATGGG - Intergenic
1195398132 X:104433216-104433238 TGGGCTTTAGTTTGTTCTATAGG + Intergenic
1195999166 X:110762552-110762574 TAGGCGTGAGACAGTGCGATCGG + Intronic
1196900533 X:120378612-120378634 TGGGCTAGAGTCTGAGCTAAAGG - Intronic
1197155573 X:123266499-123266521 TGAGCTTGAGTCAGTGGCAGTGG - Intronic