ID: 1160054674

View in Genome Browser
Species Human (GRCh38)
Location 18:75467263-75467285
Sequence CTTTCCTCCAGCACAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160054663_1160054674 23 Left 1160054663 18:75467217-75467239 CCCACCCCAGCCATTTGGATTCG No data
Right 1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG No data
1160054667_1160054674 18 Left 1160054667 18:75467222-75467244 CCCAGCCATTTGGATTCGGAGAC No data
Right 1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG No data
1160054670_1160054674 -6 Left 1160054670 18:75467246-75467268 CCATTTAAGATGCACAGCTTTCC No data
Right 1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG No data
1160054666_1160054674 19 Left 1160054666 18:75467221-75467243 CCCCAGCCATTTGGATTCGGAGA No data
Right 1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG No data
1160054664_1160054674 22 Left 1160054664 18:75467218-75467240 CCACCCCAGCCATTTGGATTCGG No data
Right 1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG No data
1160054668_1160054674 17 Left 1160054668 18:75467223-75467245 CCAGCCATTTGGATTCGGAGACT No data
Right 1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG No data
1160054669_1160054674 13 Left 1160054669 18:75467227-75467249 CCATTTGGATTCGGAGACTCCAT No data
Right 1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG No data
1160054662_1160054674 24 Left 1160054662 18:75467216-75467238 CCCCACCCCAGCCATTTGGATTC No data
Right 1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160054674 Original CRISPR CTTTCCTCCAGCACAGGGGC TGG Intergenic
No off target data available for this crispr