ID: 1160057385

View in Genome Browser
Species Human (GRCh38)
Location 18:75496331-75496353
Sequence GCTCCTTTCAACCATGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160057382_1160057385 14 Left 1160057382 18:75496294-75496316 CCTAAGAAGCAGGAAGATGGTAT No data
Right 1160057385 18:75496331-75496353 GCTCCTTTCAACCATGACTGTGG No data
1160057384_1160057385 -10 Left 1160057384 18:75496318-75496340 CCGGATGACTTCAGCTCCTTTCA No data
Right 1160057385 18:75496331-75496353 GCTCCTTTCAACCATGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160057385 Original CRISPR GCTCCTTTCAACCATGACTG TGG Intergenic
No off target data available for this crispr