ID: 1160057686

View in Genome Browser
Species Human (GRCh38)
Location 18:75500049-75500071
Sequence CTGTTTCCACAGAGAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160057686_1160057689 -4 Left 1160057686 18:75500049-75500071 CCTTCCTTTCTCTGTGGAAACAG No data
Right 1160057689 18:75500068-75500090 ACAGAATATGTGTTTTAACAGGG No data
1160057686_1160057691 7 Left 1160057686 18:75500049-75500071 CCTTCCTTTCTCTGTGGAAACAG No data
Right 1160057691 18:75500079-75500101 GTTTTAACAGGGTTCCTTTTGGG No data
1160057686_1160057690 6 Left 1160057686 18:75500049-75500071 CCTTCCTTTCTCTGTGGAAACAG No data
Right 1160057690 18:75500078-75500100 TGTTTTAACAGGGTTCCTTTTGG No data
1160057686_1160057688 -5 Left 1160057686 18:75500049-75500071 CCTTCCTTTCTCTGTGGAAACAG No data
Right 1160057688 18:75500067-75500089 AACAGAATATGTGTTTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160057686 Original CRISPR CTGTTTCCACAGAGAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr