ID: 1160062093

View in Genome Browser
Species Human (GRCh38)
Location 18:75540103-75540125
Sequence TTGAATCTGCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160062089_1160062093 25 Left 1160062089 18:75540055-75540077 CCAAAAGAAGTTCTTCAAATAGA No data
Right 1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160062093 Original CRISPR TTGAATCTGCAGAAGGAGGA AGG Intergenic
No off target data available for this crispr