ID: 1160065175

View in Genome Browser
Species Human (GRCh38)
Location 18:75567452-75567474
Sequence TCCCAAGATCGCTGAAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160065175_1160065177 -3 Left 1160065175 18:75567452-75567474 CCTTGGCTTCAGCGATCTTGGGA No data
Right 1160065177 18:75567472-75567494 GGAGTGAAGGTAAACACCCCAGG No data
1160065175_1160065181 23 Left 1160065175 18:75567452-75567474 CCTTGGCTTCAGCGATCTTGGGA No data
Right 1160065181 18:75567498-75567520 ACCTATTATCTCTTAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160065175 Original CRISPR TCCCAAGATCGCTGAAGCCA AGG (reversed) Intergenic
No off target data available for this crispr