ID: 1160066632

View in Genome Browser
Species Human (GRCh38)
Location 18:75581495-75581517
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160066632_1160066639 2 Left 1160066632 18:75581495-75581517 CCTTTCTCTCCCCACACCCACCG No data
Right 1160066639 18:75581520-75581542 AGTGTGTTTGTCTAGAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160066632 Original CRISPR CGGTGGGTGTGGGGAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr